ID: 1179993007

View in Genome Browser
Species Human (GRCh38)
Location 21:44958383-44958405
Sequence CGCAGCACCGGCGAGAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179992998_1179993007 25 Left 1179992998 21:44958335-44958357 CCTCCAAGCTGGCATTTCTGCTG 0: 1
1: 0
2: 5
3: 42
4: 278
Right 1179993007 21:44958383-44958405 CGCAGCACCGGCGAGAGCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1179992997_1179993007 28 Left 1179992997 21:44958332-44958354 CCTCCTCCAAGCTGGCATTTCTG 0: 1
1: 0
2: 1
3: 31
4: 320
Right 1179993007 21:44958383-44958405 CGCAGCACCGGCGAGAGCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1179993002_1179993007 0 Left 1179993002 21:44958360-44958382 CCCACGGGACGCTCCTGTGCTTC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1179993007 21:44958383-44958405 CGCAGCACCGGCGAGAGCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1179992996_1179993007 29 Left 1179992996 21:44958331-44958353 CCCTCCTCCAAGCTGGCATTTCT 0: 1
1: 1
2: 1
3: 37
4: 364
Right 1179993007 21:44958383-44958405 CGCAGCACCGGCGAGAGCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1179992999_1179993007 22 Left 1179992999 21:44958338-44958360 CCAAGCTGGCATTTCTGCTGCAC 0: 1
1: 0
2: 3
3: 26
4: 226
Right 1179993007 21:44958383-44958405 CGCAGCACCGGCGAGAGCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1179993003_1179993007 -1 Left 1179993003 21:44958361-44958383 CCACGGGACGCTCCTGTGCTTCC 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1179993007 21:44958383-44958405 CGCAGCACCGGCGAGAGCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179993007 Original CRISPR CGCAGCACCGGCGAGAGCTG TGG Intronic