ID: 1179993009

View in Genome Browser
Species Human (GRCh38)
Location 21:44958391-44958413
Sequence CGGCGAGAGCTGTGGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179993003_1179993009 7 Left 1179993003 21:44958361-44958383 CCACGGGACGCTCCTGTGCTTCC 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1179993009 21:44958391-44958413 CGGCGAGAGCTGTGGTGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 112
1179993005_1179993009 -5 Left 1179993005 21:44958373-44958395 CCTGTGCTTCCGCAGCACCGGCG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1179993009 21:44958391-44958413 CGGCGAGAGCTGTGGTGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 112
1179993002_1179993009 8 Left 1179993002 21:44958360-44958382 CCCACGGGACGCTCCTGTGCTTC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1179993009 21:44958391-44958413 CGGCGAGAGCTGTGGTGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 112
1179992999_1179993009 30 Left 1179992999 21:44958338-44958360 CCAAGCTGGCATTTCTGCTGCAC 0: 1
1: 0
2: 3
3: 26
4: 226
Right 1179993009 21:44958391-44958413 CGGCGAGAGCTGTGGTGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179993009 Original CRISPR CGGCGAGAGCTGTGGTGTGC TGG Intronic