ID: 1179993010

View in Genome Browser
Species Human (GRCh38)
Location 21:44958403-44958425
Sequence TGGTGTGCTGGCCTTGTCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 91}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179993002_1179993010 20 Left 1179993002 21:44958360-44958382 CCCACGGGACGCTCCTGTGCTTC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1179993010 21:44958403-44958425 TGGTGTGCTGGCCTTGTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 91
1179993005_1179993010 7 Left 1179993005 21:44958373-44958395 CCTGTGCTTCCGCAGCACCGGCG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1179993010 21:44958403-44958425 TGGTGTGCTGGCCTTGTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 91
1179993008_1179993010 -10 Left 1179993008 21:44958390-44958412 CCGGCGAGAGCTGTGGTGTGCTG 0: 1
1: 0
2: 0
3: 12
4: 203
Right 1179993010 21:44958403-44958425 TGGTGTGCTGGCCTTGTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 91
1179993006_1179993010 -2 Left 1179993006 21:44958382-44958404 CCGCAGCACCGGCGAGAGCTGTG 0: 1
1: 1
2: 2
3: 14
4: 100
Right 1179993010 21:44958403-44958425 TGGTGTGCTGGCCTTGTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 91
1179993003_1179993010 19 Left 1179993003 21:44958361-44958383 CCACGGGACGCTCCTGTGCTTCC 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1179993010 21:44958403-44958425 TGGTGTGCTGGCCTTGTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179993010 Original CRISPR TGGTGTGCTGGCCTTGTCGT AGG Intronic