ID: 1179995055

View in Genome Browser
Species Human (GRCh38)
Location 21:44970429-44970451
Sequence CTGGGTTACCTGTTGGTGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179995055_1179995066 29 Left 1179995055 21:44970429-44970451 CCGAGCACCAACAGGTAACCCAG 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1179995066 21:44970481-44970503 GCTGTTTCTCTAGGGAGCCCTGG 0: 1
1: 1
2: 18
3: 80
4: 463
1179995055_1179995064 21 Left 1179995055 21:44970429-44970451 CCGAGCACCAACAGGTAACCCAG 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1179995064 21:44970473-44970495 CCAGTCCTGCTGTTTCTCTAGGG 0: 1
1: 0
2: 1
3: 36
4: 224
1179995055_1179995062 20 Left 1179995055 21:44970429-44970451 CCGAGCACCAACAGGTAACCCAG 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1179995062 21:44970472-44970494 GCCAGTCCTGCTGTTTCTCTAGG 0: 1
1: 0
2: 3
3: 20
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179995055 Original CRISPR CTGGGTTACCTGTTGGTGCT CGG (reversed) Intronic
901876559 1:12170002-12170024 CTGGGGTACCTGCTGGCCCTGGG + Intronic
906001798 1:42432800-42432822 CTGAGTTCCCTGTTGCTGCGGGG - Intronic
907230475 1:52993785-52993807 ATTGATTACCTCTTGGTGCTGGG - Intronic
907664901 1:56426162-56426184 CTGGGTTAGCTGCTGCTGTTGGG - Intergenic
908375105 1:63529122-63529144 CTTACTTACCTGTTGTTGCTAGG + Intronic
913337181 1:117719114-117719136 CTGGGCTCCAGGTTGGTGCTAGG - Intergenic
914261090 1:145999785-145999807 CTTGGTTTCCTGTTGGCACTGGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
919196436 1:194293142-194293164 GTGAGTTACCAGTTGCTGCTAGG + Intergenic
920650079 1:207831155-207831177 CGGGAGTCCCTGTTGGTGCTGGG - Intergenic
922703007 1:227772792-227772814 CTGGTTTACCAGATGGTGTTGGG - Intronic
1063259972 10:4377107-4377129 CTGGGTTACCTTTCATTGCTAGG + Intergenic
1063496959 10:6519140-6519162 ATGGGTTGCCTTTTGGTGTTCGG + Intronic
1066061853 10:31731041-31731063 CTTGGTAACCAGTAGGTGCTAGG + Intergenic
1066294371 10:34041477-34041499 CTTAGTTTCCTGTTGCTGCTAGG - Intergenic
1068426533 10:56872645-56872667 CTTGGTTAACTGCAGGTGCTTGG - Intergenic
1070492704 10:76992631-76992653 CTGGGTTCCCTCATGGTGGTAGG - Intronic
1071307795 10:84314397-84314419 CTGAGTTGCCTCTTGGTGCAGGG - Intergenic
1073721041 10:106172028-106172050 CTGGCTTACCTTTTGTGGCTGGG - Intergenic
1074470620 10:113723335-113723357 CTGGGTTGCCTGTTAGAACTTGG - Intronic
1075489026 10:122850320-122850342 CTGGGCTTCCTGTTGGAGCAAGG - Intronic
1076546874 10:131251257-131251279 CTGGGCTACCTGCCTGTGCTGGG + Intronic
1076755744 10:132570772-132570794 CTGGGTGACTGGCTGGTGCTGGG + Intronic
1079911080 11:26310904-26310926 CTGGTTTACCAGTTGCTTCTAGG - Intronic
1080057155 11:27918104-27918126 CTCGCTCACCTGTTGGTCCTGGG - Intergenic
1080616598 11:33949875-33949897 CTGGATCACCTCTTGGTGATAGG + Intergenic
1081369260 11:42278848-42278870 CTGGGTTTCCTTTTGTTGGTAGG - Intergenic
1083119946 11:60501931-60501953 ATGGGTTAACTGGTTGTGCTTGG - Intronic
1083431413 11:62615391-62615413 CTGGGTAACTTATTGGGGCTGGG - Exonic
1084041560 11:66545885-66545907 CTGGCTTACGTGCTGGTGCTCGG - Exonic
1084519389 11:69654388-69654410 GCCGGTTACATGTTGGTGCTGGG - Exonic
1086759698 11:90612527-90612549 CTAGGTAGCCTGTAGGTGCTGGG + Intergenic
1089325851 11:117656300-117656322 CAGGGTTACCTGGTGGAGCCAGG - Intronic
1091387842 12:105911-105933 TTGGGAAACCTGTTGGTGCTTGG + Intronic
1096623071 12:52876589-52876611 CTGGGTTGGCAGCTGGTGCTGGG - Intergenic
1102786815 12:115611760-115611782 CTGGGCAGCCAGTTGGTGCTGGG - Intergenic
1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG + Exonic
1104835631 12:131788276-131788298 TTGTGTGACCTGTTAGTGCTCGG - Intronic
1105708544 13:22983421-22983443 CTGGGTTCCCTGCTGCTGGTGGG - Intergenic
1108246032 13:48515196-48515218 CTAGGTTACCTGTTGTTGCAAGG + Exonic
1108593398 13:51930088-51930110 CTGGCTTTCCTTTTGGGGCTGGG + Intergenic
1110253806 13:73409754-73409776 CTGGGCCACAGGTTGGTGCTGGG + Intergenic
1113629957 13:111875389-111875411 CAGGGTTCCCTGTGGGAGCTCGG + Intergenic
1117058565 14:51937514-51937536 CTGGGTTGTCTATAGGTGCTAGG + Intronic
1127824639 15:62692197-62692219 CTGGGCTACCTGCTATTGCTGGG + Intronic
1131016345 15:89060521-89060543 ATGAGTTTCCTGTTTGTGCTGGG - Intergenic
1137381582 16:48004250-48004272 CTGGGTTACTTGTTACAGCTTGG - Intergenic
1139576411 16:67845200-67845222 CTGGGTTTACTGTGGGTGGTGGG + Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140222649 16:73055296-73055318 GTGGGTTTTCTGTTGTTGCTGGG + Intronic
1141640007 16:85335512-85335534 CTGGGCTCCCTGCAGGTGCTGGG + Intergenic
1144088268 17:11830285-11830307 CTGAGTTAAATGTAGGTGCTGGG - Intronic
1144334034 17:14253129-14253151 CTGGGTTCCCTGTTCGTACAAGG - Intergenic
1147042935 17:37731870-37731892 CGGGGGGACTTGTTGGTGCTTGG + Intronic
1147558290 17:41493598-41493620 CTGGGTGACCGTTGGGTGCTGGG - Intergenic
1148845384 17:50527013-50527035 CTGGGTTACCTGTTTTTGTCTGG + Intronic
1148884348 17:50760703-50760725 CAGGGTGAGCTGATGGTGCTAGG - Intergenic
1151698984 17:75732474-75732496 CGGGGTTGGCTGTTGGGGCTGGG + Intronic
1152320169 17:79604320-79604342 CTGGGTTTCCTTTTTTTGCTCGG + Intergenic
1152893619 17:82896904-82896926 CTGGGGTCCGTGCTGGTGCTGGG + Intronic
1156479124 18:37425178-37425200 CTGGGCAACCTGAAGGTGCTCGG + Intronic
1162340899 19:10091236-10091258 CCGGGATACCTGGTGGTGGTGGG - Exonic
1162565902 19:11445820-11445842 CTGGGTTACCTGGTGGAGGGTGG + Intronic
1166680477 19:44763229-44763251 CTGGGTGACCTGTGTGTGCCTGG + Intergenic
1167758482 19:51427940-51427962 CTGGGTTACCTGTTTGTATAAGG - Intergenic
1168288818 19:55347290-55347312 CTGGGGTAGCTGGTGGGGCTGGG - Exonic
925098483 2:1226431-1226453 CTGTATTCCCAGTTGGTGCTGGG - Intronic
930498082 2:52174565-52174587 ATGGGTTACAGGTTGGTGTTTGG - Intergenic
933497554 2:83068579-83068601 CTGGGTCACGTGTTTGTGTTGGG - Intergenic
934020035 2:87939480-87939502 CTGTGTGACCAGATGGTGCTAGG - Intergenic
934906543 2:98210014-98210036 CTGGGCTGCCTGCTGTTGCTGGG + Intronic
937264502 2:120607426-120607448 CTGGGTAACCTGCCTGTGCTGGG - Intergenic
938976099 2:136480232-136480254 CTGGTTTCCCTGTTGTTCCTTGG + Intergenic
939071138 2:137544940-137544962 CTGGCTTAGCTGTTAGTGATTGG + Intronic
939891902 2:147746516-147746538 CTGGGTTCCCTGATGGTACATGG - Intergenic
944096080 2:195969155-195969177 CTTGGTTTCCTGTGGGTGGTGGG + Intronic
944368015 2:198947303-198947325 CAGTGTGACATGTTGGTGCTAGG + Intergenic
944855565 2:203763911-203763933 CTGGGTGACCTCTGGGTGTTTGG + Intergenic
947603597 2:231469399-231469421 CTGGGGGACCTGGTGGAGCTGGG - Intronic
1169181356 20:3570863-3570885 CTGGGTTGGCTGTTGTTTCTAGG + Intronic
1171260035 20:23724062-23724084 CTGGGTTACCTGGGTGTGCAGGG + Intergenic
1171269106 20:23799595-23799617 CTGGGTTACCTGGGTGTGCAGGG + Intergenic
1172594695 20:36142683-36142705 CTGGGTGGCCTGATGGGGCTGGG + Intronic
1173932511 20:46832648-46832670 CTGGGTCATCTGCTGGGGCTGGG - Intergenic
1175326834 20:58135481-58135503 CTGGCTTACCTGAGGGGGCTTGG - Intergenic
1179995055 21:44970429-44970451 CTGGGTTACCTGTTGGTGCTCGG - Intronic
1180062382 21:45392321-45392343 CTGAGTTTCCAGTCGGTGCTGGG + Intergenic
1180077053 21:45468287-45468309 CTGGGTGACCTGCTGGGGCGGGG - Exonic
1182295157 22:29307959-29307981 CTGGTTTACATGTTGGCTCTGGG - Intronic
1183457803 22:37932336-37932358 CTGGAGTGTCTGTTGGTGCTGGG + Intronic
1183665465 22:39243753-39243775 CTGGGTGACCTCTTCGGGCTGGG - Intronic
1184149430 22:42629675-42629697 CAGGGGTACCTGAGGGTGCTGGG + Intronic
1184220791 22:43098532-43098554 CTGCCTTTCCTGTTGGGGCTGGG - Intergenic
949134994 3:553944-553966 CTGGGTATCCTGTTGGTCCAAGG - Intergenic
961080799 3:124025635-124025657 CTCGGTTACCTAGTGGTTCTTGG + Intergenic
964041682 3:152268831-152268853 CTGGGCTTCCTGGTGGGGCTGGG + Exonic
964791144 3:160453694-160453716 CTGGGTAACTTATTGGGGCTGGG + Intronic
966296854 3:178433913-178433935 CTGGGTAACCTATTGTTGTTTGG + Intronic
968630451 4:1648228-1648250 CTGGGTTACCTGTCAGTTCCTGG - Intronic
970440278 4:16075872-16075894 CTCGGCTCCCTGTTGCTGCTGGG - Exonic
973034930 4:45394127-45394149 CTGGGCTACCTGGTCATGCTAGG + Intergenic
976453901 4:85223505-85223527 GTGGGTTCCCTTTTGGTGCAGGG + Intergenic
977114086 4:92999398-92999420 CTGGGAAACCTGTTAGTCCTTGG + Intronic
978109209 4:104942483-104942505 CTGGGTTAAATGGTGGTGGTGGG - Intergenic
979454878 4:120915922-120915944 CTGTGTTATTTTTTGGTGCTGGG - Intronic
983600578 4:169522663-169522685 CTGGGCTACCGGCTGTTGCTGGG + Intronic
994274746 5:97822268-97822290 GTGGGTTACCTTTTGGTCTTTGG + Intergenic
996273738 5:121639751-121639773 CTGGTTTCCCTATTGGTCCTTGG - Intergenic
997737584 5:136225477-136225499 CTGATTTACCTGGTGCTGCTTGG + Intronic
998385521 5:141755008-141755030 CTGGGATTCCTGTGGGGGCTGGG + Intergenic
998778885 5:145634027-145634049 CTTGGTTGCCTGTGGGAGCTGGG - Intronic
1005755855 6:28924244-28924266 TTGGGTTTCCTCTTGGTGCCAGG + Intergenic
1008539566 6:52534916-52534938 CTGGGCTCCCTGTAAGTGCTTGG + Intronic
1013072315 6:106740524-106740546 CTGGGTTTCCTGCTGTTGCCTGG + Intergenic
1015305596 6:131703704-131703726 CTGAGTTTACTGATGGTGCTGGG + Intronic
1017962412 6:159233550-159233572 CTGGGGTCCCGGGTGGTGCTGGG - Exonic
1023059030 7:36311831-36311853 CTGGGTTACCTGCTCCAGCTAGG - Intergenic
1023224304 7:37952861-37952883 CTGGGTCACCTCTTGGTGGCAGG + Intronic
1024531243 7:50394209-50394231 CTGCATAATCTGTTGGTGCTTGG + Intronic
1026555345 7:71403780-71403802 CAGGGTTACACGCTGGTGCTTGG - Intronic
1029245552 7:99197341-99197363 CAGGGTTTGCTGTTGTTGCTGGG - Intronic
1031979139 7:128113080-128113102 CTGGGCTCCCTGTGGGTCCTTGG + Intergenic
1033739712 7:144261935-144261957 CTGAGTTTACTGATGGTGCTGGG + Intergenic
1042863270 8:73334662-73334684 CTGGGTTGCCTCTTGGAGTTAGG + Intergenic
1043571685 8:81610900-81610922 CTGTGTTCCCTGTGGGTCCTTGG - Intergenic
1049432529 8:142571878-142571900 CTGCATTACCTGTTTGAGCTGGG - Intergenic
1049981685 9:909561-909583 CTGGGTCTTCTGGTGGTGCTGGG - Intronic
1051573640 9:18588754-18588776 ATGGGTTGGCTGTTGGTGCATGG + Intronic
1052107774 9:24541174-24541196 CTGTATTACCTGTTGCTGGTGGG + Intergenic
1052308951 9:27043135-27043157 CAGGGTTTCCTATTGGTGCTGGG + Intronic
1052832551 9:33228186-33228208 CTGGGTTACCTGGGTGAGCTTGG - Intronic
1056378271 9:86035275-86035297 CAGGGTGATATGTTGGTGCTGGG + Intronic
1057902380 9:98959684-98959706 CTGTGTTACCTCTTTCTGCTGGG + Intronic
1060210697 9:121708474-121708496 CTGGGTCTCCTGAGGGTGCTTGG + Intronic
1060302174 9:122381222-122381244 GTGGGTTACTTGGTGGTGGTGGG + Intronic
1060486508 9:124050928-124050950 CTGGGTTACTTCTGTGTGCTTGG + Intergenic
1060916876 9:127397238-127397260 CTGGGTTTCCTCTGGGTCCTCGG - Exonic
1061392865 9:130327462-130327484 TGGGGTTACCTGTTGGTGATGGG - Intronic
1192495822 X:71616223-71616245 CCGGGAGACCTGGTGGTGCTGGG + Exonic
1196458673 X:115907611-115907633 CTGGGTTGTCTGTAGGTGCTGGG - Intergenic
1198794892 X:140384380-140384402 CTGTGCTACCTGTAGGTGCTTGG + Intergenic
1199124490 X:144099650-144099672 CTGTGTGACCAGATGGTGCTAGG + Intergenic
1201855240 Y:18534270-18534292 TTGGGTTTACTGTTGGTGTTAGG + Intergenic