ID: 1179995512

View in Genome Browser
Species Human (GRCh38)
Location 21:44972255-44972277
Sequence GTTCACATGGGACAGCGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179995512_1179995520 4 Left 1179995512 21:44972255-44972277 CCAGGTCGCTGTCCCATGTGAAC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1179995520 21:44972282-44972304 GGCCAGGTGGGCGGCTGCCTTGG 0: 1
1: 0
2: 3
3: 35
4: 422
1179995512_1179995519 -5 Left 1179995512 21:44972255-44972277 CCAGGTCGCTGTCCCATGTGAAC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1179995519 21:44972273-44972295 TGAACATTCGGCCAGGTGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 138
1179995512_1179995526 28 Left 1179995512 21:44972255-44972277 CCAGGTCGCTGTCCCATGTGAAC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1179995526 21:44972306-44972328 CGGCTGACCACAAGGAGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 102
1179995512_1179995517 -9 Left 1179995512 21:44972255-44972277 CCAGGTCGCTGTCCCATGTGAAC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1179995517 21:44972269-44972291 CATGTGAACATTCGGCCAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 64
1179995512_1179995523 20 Left 1179995512 21:44972255-44972277 CCAGGTCGCTGTCCCATGTGAAC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1179995523 21:44972298-44972320 GCCTTGGCCGGCTGACCACAAGG 0: 1
1: 0
2: 2
3: 21
4: 543
1179995512_1179995518 -8 Left 1179995512 21:44972255-44972277 CCAGGTCGCTGTCCCATGTGAAC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1179995518 21:44972270-44972292 ATGTGAACATTCGGCCAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 59
1179995512_1179995522 8 Left 1179995512 21:44972255-44972277 CCAGGTCGCTGTCCCATGTGAAC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1179995522 21:44972286-44972308 AGGTGGGCGGCTGCCTTGGCCGG 0: 1
1: 0
2: 0
3: 22
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179995512 Original CRISPR GTTCACATGGGACAGCGACC TGG (reversed) Intronic
904784134 1:32973031-32973053 GGTCACATGGCACCGCCACCGGG - Intergenic
907647799 1:56261604-56261626 GTTCACATGGGACACAGAGATGG + Intergenic
907783710 1:57591337-57591359 TTTCACATGGGCCAGTCACCAGG - Intronic
908465639 1:64390903-64390925 GTTCAGAGGGGACAGAAACCAGG + Intergenic
918616958 1:186555750-186555772 GTTCACAGAAGACAGCAACCTGG - Intergenic
1069965298 10:72110312-72110334 GTACACAGGGGACAGCAACAGGG + Intronic
1070680873 10:78448206-78448228 GCTCACATGGGTCAGGAACCTGG + Intergenic
1070890786 10:79941190-79941212 GTACTCATGGGAAAGCAACCTGG - Intronic
1072795722 10:98353043-98353065 GTTCACTTGGAACAGTGAACAGG + Intergenic
1077725744 11:4673177-4673199 GTTCACAAGGATCAGCGTCCTGG - Intergenic
1103991268 12:124800882-124800904 GTTAACAAGGAACAGCGAGCGGG + Intronic
1104419173 12:128621112-128621134 GTTCACATGGGCCAGCCCCCAGG - Intronic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1113669854 13:112168999-112169021 GTTCACATGGGAGAGCGGAAAGG - Intergenic
1114206611 14:20577902-20577924 GTGCACATGGAACATCCACCAGG + Intergenic
1119565658 14:75627017-75627039 GTTCTCATGAGTCAGTGACCTGG - Intronic
1122651352 14:103228808-103228830 GTCCACTGGGGACAGTGACCAGG + Intergenic
1126624862 15:50676909-50676931 GTACACATGGGGCAGCCTCCAGG + Intronic
1128668165 15:69553785-69553807 GTTCATATAGGTCAGTGACCCGG + Intergenic
1132357799 15:101185572-101185594 GGTCACATGGGAGGGCTACCTGG - Intronic
1133931315 16:10234586-10234608 GTTCTCATGGGAAAGGGAACTGG - Intergenic
1138392356 16:56679353-56679375 GATCAAATGGGACAGTGGCCTGG + Intronic
1141394737 16:83694645-83694667 GGTGACATGGGCCAGCAACCAGG + Intronic
1151790809 17:76304682-76304704 GCTCACATGGGACAGATAACTGG - Intronic
1152513080 17:80803462-80803484 GGCCACAGGGCACAGCGACCAGG - Intronic
1163634150 19:18430730-18430752 GGCCCCATGGGACAGCGAGCTGG - Intronic
925421647 2:3717601-3717623 GATCACATGGGAAAGGGACAAGG - Intronic
932360390 2:71100622-71100644 GTACACATGGAACAGCTACAAGG - Intergenic
934985121 2:98879672-98879694 GTGCACCTGGGACAGCTACTCGG - Intronic
936383819 2:112011392-112011414 CTTCACTTGGAAAAGCGACCTGG - Intronic
937015207 2:118598863-118598885 GAACACATGGGACAGAGTCCAGG + Intergenic
938613578 2:132974319-132974341 GTTCACATGAGGCAGAGATCAGG + Intronic
940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG + Intergenic
941838458 2:170052667-170052689 GTTCACATGGGACAGGGAGGTGG + Intronic
942153704 2:173105169-173105191 GATTACATGGGACAGAGACAGGG + Intronic
944175872 2:196828883-196828905 CCTCAGATGGGACAGCAACCTGG + Intergenic
1178667830 21:34564389-34564411 GTTCTTATGGGACAGTGTCCGGG - Intronic
1179190392 21:39117818-39117840 GTGAACATGGGACAGCGAGAAGG - Intergenic
1179995512 21:44972255-44972277 GTTCACATGGGACAGCGACCTGG - Intronic
1182453607 22:30435618-30435640 GTTCACATGGGAGAGGGTGCAGG - Intergenic
1183541517 22:38431813-38431835 GTTCTCATGTGACAACCACCAGG + Intronic
1185202169 22:49514267-49514289 CTTCACATGAGGCAGGGACCCGG - Intronic
950523233 3:13508670-13508692 GTCCAGATGAGACAGAGACCCGG + Intergenic
950638151 3:14330558-14330580 GTTCCCAAGGGGCAGGGACCTGG + Intergenic
954807912 3:53230970-53230992 GTTCCCTTGGGACAGAAACCTGG + Intronic
959593156 3:108101187-108101209 GTTCATTTGTGACAGCCACCTGG + Intergenic
961810199 3:129517733-129517755 GCCCACATGGGACAGGGACAGGG + Intronic
963761910 3:149293278-149293300 CTTCAAATGGGTCAGAGACCTGG - Intergenic
969317981 4:6393652-6393674 GTGCACAAGGGACAGGGATCGGG + Intronic
975210753 4:71697239-71697261 GCTCACATGGGACAGCCAGAAGG - Intergenic
975797289 4:78020812-78020834 GTTAACATGGAACAGTGACCTGG + Intergenic
976284931 4:83362165-83362187 GTTCACAAGGGACTGGCACCAGG - Intergenic
976729175 4:88245008-88245030 TGTCACATGGGACAGCTGCCTGG - Intergenic
985615259 5:916299-916321 GCTCACATAGAACAGTGACCTGG + Intronic
985811572 5:2094082-2094104 TTTCGCATGGGAGAGCGTCCTGG + Intergenic
985811583 5:2094149-2094171 TTTCAAATGGGAGAGCGTCCTGG + Intergenic
985811595 5:2094216-2094238 TTTCACATGGGAGAGCGTCCTGG + Intergenic
986563713 5:9089392-9089414 GTTCAAATGGGTCAGAGGCCAGG + Intronic
989623804 5:43410565-43410587 CTTCACATGGGACTGAGTCCTGG - Intronic
992206470 5:74435073-74435095 GTTCACATGGGATGGTGGCCTGG + Intergenic
997477069 5:134149450-134149472 TTTCACATGGGACAGCCACTGGG + Exonic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1006085028 6:31589370-31589392 GTTCCCATGTGACAGTGGCCTGG + Intronic
1007757313 6:44108387-44108409 GTACACATGGGTCAGGGAGCAGG - Intergenic
1023912744 7:44567153-44567175 GTTCCCATGGGACAGTGAGCTGG - Intronic
1024783786 7:52882871-52882893 GTTGACATGAGCCAGCAACCAGG + Intergenic
1029812766 7:103065943-103065965 GTTCACATGACACAGCTTCCAGG - Intronic
1032584528 7:133134240-133134262 GATGAAATGGGACAGCCACCCGG - Intergenic
1047611488 8:126525286-126525308 ATTCACATGGGATAGTGATCTGG - Intergenic
1048576581 8:135695146-135695168 GTTGCCATAGGACAGGGACCAGG - Intergenic
1057083101 9:92187555-92187577 GTTCACATGGGTCAGCTGCCAGG + Intergenic
1198829886 X:140739088-140739110 GTTCATATGGGAAAGCGTCTAGG - Intergenic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic