ID: 1179995724

View in Genome Browser
Species Human (GRCh38)
Location 21:44973280-44973302
Sequence GAGCTGAACCCCTGAGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 394}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179995724_1179995731 11 Left 1179995724 21:44973280-44973302 CCACCTCCTCAGGGGTTCAGCTC 0: 1
1: 0
2: 3
3: 27
4: 394
Right 1179995731 21:44973314-44973336 CACCCTGCCCACCCTCTCCAGGG 0: 1
1: 6
2: 7
3: 73
4: 594
1179995724_1179995730 10 Left 1179995724 21:44973280-44973302 CCACCTCCTCAGGGGTTCAGCTC 0: 1
1: 0
2: 3
3: 27
4: 394
Right 1179995730 21:44973313-44973335 TCACCCTGCCCACCCTCTCCAGG 0: 1
1: 6
2: 4
3: 67
4: 538
1179995724_1179995732 12 Left 1179995724 21:44973280-44973302 CCACCTCCTCAGGGGTTCAGCTC 0: 1
1: 0
2: 3
3: 27
4: 394
Right 1179995732 21:44973315-44973337 ACCCTGCCCACCCTCTCCAGGGG 0: 1
1: 5
2: 5
3: 48
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179995724 Original CRISPR GAGCTGAACCCCTGAGGAGG TGG (reversed) Intronic
900794615 1:4700533-4700555 GAGCTGACCCCCAGGGGATGAGG + Intronic
901089834 1:6633824-6633846 CAGCTGAACCCGGGAGGTGGAGG + Intronic
901181000 1:7341844-7341866 GAGCTGGCCTCCTGGGGAGGAGG + Intronic
901930426 1:12593502-12593524 GAGCAGAACCTGTGAGAAGGTGG - Intronic
902911051 1:19597328-19597350 GAGTTGCAGCCCGGAGGAGGTGG + Intronic
906711316 1:47932015-47932037 GAGATGAAGTCCTGGGGAGGAGG + Intronic
907466281 1:54639894-54639916 TAGCTGTTCCCCTGACGAGGAGG + Intergenic
908865122 1:68539649-68539671 CACCTGAACCCCTGAGGCAGAGG - Intergenic
909717260 1:78724576-78724598 GAGCTGAAGCCCTGAGAACCAGG + Intergenic
909931384 1:81503334-81503356 GAGCAGACCCCGTGATGAGGTGG - Intronic
910572355 1:88720115-88720137 CAGCTGAACCCCAGAGGTTGAGG - Intronic
910813104 1:91257825-91257847 CACCTGAACCCCGGAGGCGGCGG + Intergenic
912510364 1:110185599-110185621 GAGCAGACACCCCGAGGAGGGGG + Intronic
912680644 1:111726899-111726921 GTGCTGGGCCCCTGGGGAGGAGG - Exonic
913281498 1:117189528-117189550 GATCTGAAGCCCTGCAGAGGTGG + Intronic
915117628 1:153610597-153610619 GAGCTGAAGCCCTGAGGCACTGG - Intronic
915371140 1:155351467-155351489 CATCTGAACCCTTGAGGCGGAGG + Intronic
915372367 1:155361787-155361809 GACTTGAACCCCTGAGGCAGAGG + Intronic
915840284 1:159207632-159207654 AAGCTGTGCCCCTGATGAGGAGG - Intergenic
916457236 1:164983292-164983314 GAGCTGAGCTCCTAAGGAGGAGG - Intergenic
916569287 1:166010725-166010747 GAGCTCAACCCCTGAGGTTCTGG - Intergenic
917060531 1:171032913-171032935 GACCTGAGCCCCTAAGGAGAGGG - Intronic
917095546 1:171395399-171395421 CACTTGAACCCCAGAGGAGGAGG + Intergenic
917259832 1:173154822-173154844 GAGCTGCACTCCTTTGGAGGAGG - Intergenic
918528935 1:185496100-185496122 GGGGTGAACCACAGAGGAGGTGG + Intergenic
919269751 1:195325162-195325184 CAGTTGAACCCCGGAGGCGGAGG - Intergenic
922283502 1:224147635-224147657 GACCCAAACCCCTGAGGATGCGG + Intronic
923052621 1:230399414-230399436 GAGCTGATCCCCACAGGAGGGGG + Intronic
1064193250 10:13225589-13225611 CACTTGAACCCCGGAGGAGGAGG + Intronic
1065081087 10:22130368-22130390 GAGCTGCATTCCTGTGGAGGGGG + Intergenic
1065291223 10:24231880-24231902 AGGCTGAACCCCGGAGGTGGAGG - Intronic
1065308491 10:24391427-24391449 TTGCTGAACCCCAGAGGTGGAGG - Intronic
1065787410 10:29229527-29229549 TGGCTGATCCCCTGGGGAGGAGG + Intergenic
1066736274 10:38483154-38483176 GGGTTGAACCCGTGAGGTGGAGG + Intergenic
1067083883 10:43228135-43228157 GAGCAGAGCCCAAGAGGAGGTGG - Intronic
1067096474 10:43304732-43304754 GAGCTGGAGAGCTGAGGAGGCGG + Intergenic
1069227269 10:65959606-65959628 GACCTGAACCCAGGAGGTGGAGG - Intronic
1069822896 10:71238554-71238576 AAGCTGAACCCAGGAGGTGGAGG - Intronic
1070575338 10:77673131-77673153 GAACTGAACCCCTGAGGTTGAGG + Intergenic
1070698373 10:78580032-78580054 GACCTGACTCCCTGAGAAGGTGG + Intergenic
1071012025 10:80950781-80950803 GAGCTGAACCAATCAGGAGAAGG + Intergenic
1072188067 10:93060908-93060930 GTGCTGAGCCCGGGAGGAGGTGG + Intergenic
1072511517 10:96130487-96130509 CAGCCGAACCCCGGAGGAAGGGG + Intronic
1072585617 10:96779180-96779202 CAGCTGAACCCAGGAGGTGGAGG - Intergenic
1073341075 10:102744723-102744745 GAGTGGAACCCCTCAGGAGGAGG + Intronic
1073349806 10:102811592-102811614 CACTTGAACCCCAGAGGAGGAGG - Intronic
1073770300 10:106728393-106728415 GAGCGAGCCCCCTGAGGAGGTGG + Intronic
1074141879 10:110680409-110680431 GAACCGAACCCCTGAGATGGGGG - Intronic
1074180278 10:111056203-111056225 CACCTGAACCCAGGAGGAGGAGG - Intergenic
1074365092 10:112851465-112851487 ACGCTGAACCCCTGTGGAAGTGG + Intergenic
1074460812 10:113635509-113635531 CACCTGAACCCAGGAGGAGGAGG - Intronic
1076062120 10:127420998-127421020 CACTTGAACCCCGGAGGAGGAGG - Intronic
1076879491 10:133232857-133232879 GTGCTGAACCCAGGAGGCGGAGG + Intergenic
1077420537 11:2447917-2447939 GAGCTGCTCTCCTGGGGAGGGGG - Intronic
1078369505 11:10733309-10733331 CACCTGAACCCCAGAGGTGGAGG + Intergenic
1081646475 11:44793820-44793842 GAGCTGAGGCCCTGGAGAGGAGG + Intronic
1083412323 11:62502754-62502776 GAGCTGAAACCCAAAGGATGAGG + Intronic
1083932005 11:65851196-65851218 GAGTTGAACCGCTGGGGAGAGGG - Intronic
1085076702 11:73598056-73598078 GAGCCGAGTCGCTGAGGAGGAGG - Exonic
1087105633 11:94403992-94404014 GAGCTGAATGCCTGGGGAAGAGG - Intergenic
1087989813 11:104734658-104734680 CACTTGAACCCCTGAGGTGGAGG + Intergenic
1089143272 11:116305341-116305363 GAGTTAAACCTCTGAGAAGGGGG - Intergenic
1089496044 11:118909196-118909218 GAGGGGAAGGCCTGAGGAGGGGG + Intronic
1090361396 11:126175237-126175259 GAGCTCCACCCCGGGGGAGGAGG + Intergenic
1090409920 11:126501071-126501093 GAAATGAAACCCAGAGGAGGAGG - Intronic
1091840125 12:3614764-3614786 GAGCAGAGCCCCTGGGTAGGGGG + Intronic
1092259974 12:6947786-6947808 GAGCTGAGACCCGGATGAGGAGG + Intronic
1092340280 12:7670065-7670087 CACCTGAACCCGGGAGGAGGAGG - Intergenic
1092527388 12:9317508-9317530 GAGCTACAGCCCTGAGGTGGAGG - Intergenic
1092539888 12:9414267-9414289 GAGCTACAGCCCTGAGGTGGAGG + Intergenic
1096496477 12:52042032-52042054 GAGGGGAAGCCCTGGGGAGGTGG + Intronic
1096602737 12:52742049-52742071 GGGCTGTAGCCCTGACGAGGAGG - Intergenic
1097120812 12:56730449-56730471 CACCTGAACCCATGAGGTGGAGG - Intronic
1097202709 12:57293081-57293103 GAGCTGAACAGTAGAGGAGGAGG + Intronic
1097883220 12:64704865-64704887 GAGCTGAGATCTTGAGGAGGAGG + Intergenic
1098472361 12:70860019-70860041 AAACTTAACCCCTGAGGAGGGGG - Intronic
1101012499 12:100465596-100465618 TAGTTGAACCCATGAGGTGGAGG + Intergenic
1101488668 12:105192111-105192133 GAGCTGAACACCTGGGCAGATGG - Intronic
1102955604 12:117056695-117056717 GAGCTGATGCCCAGAAGAGGGGG - Intronic
1103038798 12:117678016-117678038 GAGTTGAACCCATGAGGCGGAGG - Intronic
1104188793 12:126458075-126458097 GAGATGAACTCCAGAGGATGAGG - Intergenic
1104763860 12:131313984-131314006 GAGCTAAGCCCCAGAGAAGGCGG + Intergenic
1104815635 12:131644072-131644094 GAGCTGAGTCCCAGAGAAGGCGG - Intergenic
1104976598 12:132554861-132554883 CACCTGAACCCCGGAGGTGGAGG + Intronic
1105280223 13:18958949-18958971 GGGCTGGACCCCTGGGGATGGGG - Intergenic
1105823475 13:24100607-24100629 GAGCTGAAGCCCATAGAAGGAGG + Intronic
1106574657 13:30963274-30963296 GAGCTGAGCTCCTGAGGAACAGG + Intronic
1107494372 13:40910422-40910444 CACCTGAACCCAGGAGGAGGAGG + Intergenic
1108003168 13:45923168-45923190 CAGTTGAACCCAGGAGGAGGAGG + Intergenic
1108946272 13:56028679-56028701 CACTTGAACCCCGGAGGAGGAGG - Intergenic
1109711053 13:66161009-66161031 GAGCTGAAACTCTGAGAAGGAGG - Intergenic
1110700534 13:78542356-78542378 GAGGTGAACCCCAGGGGAAGAGG + Intergenic
1111534666 13:89586982-89587004 CAGCTGAACCCTGGAGGCGGAGG + Intergenic
1113814832 13:113162853-113162875 GACCTGAGCACCTGAGCAGGAGG - Intronic
1114398003 14:22384182-22384204 CTACTGAACCCCTGAGAAGGAGG - Intergenic
1114518362 14:23316675-23316697 GACTTGAACCCGTGAGGCGGAGG - Intronic
1115416641 14:33143019-33143041 GACTTGAACCCGGGAGGAGGAGG + Intronic
1116428670 14:44820738-44820760 GAACTGAGCCCCTGTGGGGGAGG + Intergenic
1116704934 14:48284750-48284772 GAGCTGCATTCCTGTGGAGGAGG + Intergenic
1117016144 14:51519246-51519268 CACTTGAACCCCTGAGGCGGAGG - Intronic
1117052402 14:51874339-51874361 GGCGTGAACCCGTGAGGAGGAGG + Intronic
1117222192 14:53617284-53617306 GAAGTGATCCCCTGAGGGGGTGG + Intergenic
1117908683 14:60615508-60615530 CACTTGAACCCCTGAGGTGGAGG + Intergenic
1118837651 14:69487966-69487988 GGCCGGAACCCCTAAGGAGGAGG + Intronic
1118976300 14:70679730-70679752 AAGCTGAACCCAGGAGGTGGAGG + Intergenic
1119438367 14:74612279-74612301 GAGCTGTCCCTCCGAGGAGGGGG - Exonic
1119643892 14:76334860-76334882 CAGCTGAAACCCTAAGGAGATGG - Intronic
1119734771 14:76974883-76974905 GAGCTTGACCCCTGAGGAAAAGG - Intergenic
1121171624 14:91859359-91859381 GAGCTAAAGACCTCAGGAGGAGG - Intronic
1121334159 14:93066920-93066942 GGGCTGAGACTCTGAGGAGGAGG - Intronic
1121343115 14:93116417-93116439 GACCCGCACCCCTGAGGAAGGGG - Intergenic
1121472448 14:94165918-94165940 GGGCTCAACCCCTCAGGAGGAGG - Intronic
1121495780 14:94390605-94390627 GAGCTGAACCAAGAAGGAGGAGG - Exonic
1122091071 14:99340958-99340980 GAGCAGAAGGCATGAGGAGGTGG + Intergenic
1122204265 14:100140807-100140829 GAGCTCCCACCCTGAGGAGGAGG + Intronic
1123401020 15:19986654-19986676 GACCTGTAATCCTGAGGAGGAGG + Intergenic
1123793954 15:23753163-23753185 GAGCTGAACCTCTGGGGTTGTGG - Intergenic
1124340010 15:28884885-28884907 GAGCTGAGACCCTAAGGAGAAGG - Intronic
1124618936 15:31263181-31263203 GTTCTGCACTCCTGAGGAGGGGG - Intergenic
1125738056 15:41942330-41942352 GAGCTGAACCTGGGAGGCGGAGG - Intronic
1126026473 15:44450678-44450700 CACCTGAACCCCAGAGGCGGAGG - Intronic
1126567263 15:50113209-50113231 GTGCTGGCCCCCTGAGGAGCAGG + Intronic
1126838639 15:52694248-52694270 CATTTGAACCCATGAGGAGGAGG - Intronic
1127264940 15:57353582-57353604 GAGCTGAACCCTTGAAGACGGGG + Intergenic
1127267986 15:57376537-57376559 GAGCTGGACGCGGGAGGAGGCGG + Exonic
1127497235 15:59524632-59524654 GGGCTGAACACCTGGGGATGGGG + Intergenic
1127757919 15:62111310-62111332 GGGCTGAGCCCATGAGGAGATGG + Intergenic
1127820091 15:62647022-62647044 AAGTAGAACCCCTTAGGAGGAGG - Intronic
1129295048 15:74595639-74595661 GAGCAGACCCCGTGATGAGGTGG - Exonic
1129690928 15:77712867-77712889 GAGCTGAATTCCTGAGGATGAGG - Intronic
1129863311 15:78881277-78881299 CACCTGAACCCCTGAGGCGGAGG - Intronic
1132775283 16:1590262-1590284 GAGCTGAACCCATGAAGTGGAGG - Intronic
1133247638 16:4459810-4459832 CAGCTGAACCCAGGAGGTGGAGG - Intergenic
1133978451 16:10617007-10617029 GAGCTGCCCCTCTGGGGAGGGGG + Intergenic
1134133222 16:11663743-11663765 CAGCTGAACCCAGGAGGCGGAGG + Intergenic
1136136030 16:28257480-28257502 GAGCTGAAACCTGCAGGAGGAGG - Intergenic
1136239081 16:28933181-28933203 GAGGTGAAACCCTGAGGATCAGG + Intronic
1136662132 16:31772135-31772157 GGACTGAACCCCTGAGGGGAGGG + Intronic
1136694817 16:32068451-32068473 GCCCTGTAACCCTGAGGAGGTGG - Intergenic
1136795318 16:33011713-33011735 GCCCTGTAACCCTGAGGAGGTGG - Intergenic
1136874602 16:33842669-33842691 GCCCTGTAACCCTGAGGAGGTGG + Intergenic
1137649995 16:50111507-50111529 CACTTGAACCCCAGAGGAGGAGG - Intergenic
1138577125 16:57915211-57915233 GAGCTGAAGGCCTGGGGTGGTGG + Intronic
1138874872 16:60937021-60937043 GAGCTGCATTCCTTAGGAGGAGG - Intergenic
1139676981 16:68530407-68530429 GAGCCGAGCCCCTGAGGAATGGG - Intronic
1139721816 16:68862296-68862318 AAGCTGAACCCGGGAGGCGGAGG - Intronic
1140087648 16:71810884-71810906 TAGCAGAACCCCAGTGGAGGAGG - Intergenic
1140498725 16:75413467-75413489 GAACTGAACCCAGGAGGCGGAGG + Intronic
1141084110 16:81079188-81079210 CACCTGAACCCGTGAGGTGGAGG + Intergenic
1141562000 16:84875638-84875660 CACTTGAACCCATGAGGAGGAGG - Intronic
1142159952 16:88552230-88552252 GACATGAAGCCCTGAGAAGGAGG - Intergenic
1142311281 16:89315460-89315482 CTGCTGAGCTCCTGAGGAGGTGG - Intronic
1203097573 16_KI270728v1_random:1273373-1273395 GCCCTGTAACCCTGAGGAGGTGG - Intergenic
1142560435 17:806185-806207 GGGCTGCAGCCCTGGGGAGGGGG - Intronic
1142560452 17:806231-806253 GGGCTGCAGCCCTGGGGAGGGGG - Intronic
1142600355 17:1050804-1050826 GGGCTGAGCCCCTAAGAAGGGGG - Intronic
1143145332 17:4771721-4771743 GAGCTGCAGCCCTGAGGTGAAGG - Intergenic
1143177677 17:4965934-4965956 CAGTTGAACCCAGGAGGAGGAGG - Intronic
1143614259 17:8039973-8039995 GAGATGTACCAGTGAGGAGGGGG + Exonic
1145165815 17:20612763-20612785 GAGCTGGGGCCCTGGGGAGGAGG + Intergenic
1145233355 17:21190970-21190992 GGGCCGAAGCCCTGTGGAGGTGG + Exonic
1146533074 17:33627179-33627201 TGGCTGAACCCCTAAGGATGAGG - Intronic
1146709968 17:35032524-35032546 GAAATGAAGCCCTCAGGAGGAGG + Intronic
1148026960 17:44595160-44595182 GAGCTGACCTCCTGATTAGGCGG + Intergenic
1150590881 17:66561048-66561070 GAGTTGACTGCCTGAGGAGGTGG + Intronic
1150604172 17:66676679-66676701 GATCAGATACCCTGAGGAGGAGG + Intronic
1150879139 17:69004162-69004184 GAGCTGCACTCCTTTGGAGGAGG + Intronic
1150908047 17:69359782-69359804 CACCTGAACCCAGGAGGAGGAGG - Intergenic
1151250706 17:72832237-72832259 GAGCTGAACCACTGAAGAAATGG + Intronic
1151504316 17:74516551-74516573 GAGCTGAGAAGCTGAGGAGGGGG + Intergenic
1151908296 17:77064033-77064055 CACCTGAACCCCAGAGGTGGAGG + Intergenic
1152273220 17:79337690-79337712 CAGCTGAACCCGTGAGGCAGAGG + Intronic
1152496844 17:80679191-80679213 GGCCTGAACCCCAGAGGTGGAGG + Intronic
1152580489 17:81163600-81163622 GAGCTGGGCTCCAGAGGAGGCGG + Intronic
1152665500 17:81566501-81566523 CAGCTGAACCTCGGAGCAGGAGG + Intronic
1155839425 18:30628399-30628421 GAGCTTGATACCTGAGGAGGTGG + Intergenic
1155926572 18:31662258-31662280 GAGTTGAGCTCCTTAGGAGGTGG - Intronic
1157730248 18:49997783-49997805 GAGTTGAAGGTCTGAGGAGGCGG - Intronic
1159939710 18:74397572-74397594 GAGCTGAGACACTGAGGAAGAGG - Intergenic
1159965473 18:74591237-74591259 AAGCAGAACTCCTGAGGAAGAGG + Intergenic
1160389555 18:78519656-78519678 CAGCTGTTCCCCTGTGGAGGCGG - Intergenic
1160502652 18:79410093-79410115 GAGCGGAACCCGTGAGGACCCGG + Intronic
1161412853 19:4126383-4126405 TAACTGAACCCCGGAGGCGGAGG + Intergenic
1161645607 19:5451558-5451580 AAACTGAGCCCCAGAGGAGGGGG - Intergenic
1162063261 19:8109639-8109661 GAGCTGAACCCCAGCGGAGTGGG - Exonic
1162380712 19:10330037-10330059 GGGCTGAACCCAGGAGGCGGAGG + Intronic
1163458025 19:17420202-17420224 GCGCTGAACCCCCGCGGCGGGGG - Exonic
1163840233 19:19603393-19603415 CACCTGAACCCATGAGGTGGAGG - Intronic
1164031365 19:21408966-21408988 GACGTGAACCCGGGAGGAGGAGG - Intronic
1164400491 19:27898829-27898851 GAGCTAAACCACAGAGGACGAGG - Intergenic
1165125859 19:33596756-33596778 CACCTGAACCCGGGAGGAGGAGG - Intergenic
1165309329 19:35021148-35021170 GAGCTGAGCCCATGTGGAGCTGG + Intronic
1165329454 19:35133589-35133611 GAGCTGTGGCCCTGAGGAGCAGG - Intronic
1165731647 19:38149661-38149683 AAGCTGTAGCCTTGAGGAGGTGG + Intronic
1166133786 19:40763172-40763194 GGGCAGGCCCCCTGAGGAGGTGG + Intronic
1166839376 19:45687354-45687376 GAGCAGGACCCCTGAGCAAGTGG - Intergenic
1167625570 19:50586154-50586176 CAGCTGAACCCGGGAGGCGGAGG + Intergenic
1168048563 19:53811428-53811450 CACTTGAACCCCTGAGGTGGAGG + Intronic
1168661142 19:58167740-58167762 TAGCTGAACCCAGGAGGTGGAGG + Intergenic
925954769 2:8952638-8952660 GAGTTGAACCCTTGAGAGGGAGG + Intronic
926110377 2:10179234-10179256 TAGCTGAACCCAGGAGGTGGAGG - Intronic
926250514 2:11153232-11153254 CAGCTGACCCCCAGAGCAGGCGG + Intergenic
926297950 2:11582096-11582118 GAGCTGGACCTCTGGGGATGAGG + Intronic
926917623 2:17908504-17908526 GAGCTGCATCCCTATGGAGGGGG + Intronic
927142613 2:20140405-20140427 GATCAGAGCCCCTGCGGAGGGGG + Intergenic
928030076 2:27770725-27770747 TAGCTGAACCCGGGAGGCGGAGG - Intergenic
929783514 2:44972960-44972982 GAGGAGATCCCCTGAAGAGGAGG - Intergenic
930042945 2:47142925-47142947 GAGATGAACCCAGGAGGTGGAGG - Intronic
930725787 2:54680045-54680067 GAGCAAAACCCCTGTGGACGTGG + Intergenic
931684298 2:64780529-64780551 TACCTGAACCCTTGAGGCGGAGG - Intergenic
933909760 2:86929801-86929823 GGGCTGGAGCCCTGAGGAGAGGG - Intronic
934022968 2:87973587-87973609 GGGCTGGAGCCCTGAGGAGAGGG + Intergenic
934892411 2:98082071-98082093 GAACACAACCCCTGAGGAAGTGG - Intergenic
934978797 2:98823486-98823508 GACGTGCACCCCAGAGGAGGAGG - Exonic
935463114 2:103362151-103362173 CAGTTGAACCCCGGAGGTGGAGG - Intergenic
936351291 2:111714639-111714661 CCGGTGAACCCCTGAGGAGAGGG - Intergenic
937445571 2:121955208-121955230 GTGCTCAACCCCTGGGGAAGAGG - Intergenic
938387528 2:130877677-130877699 GAGAAGGACCCCTGAGAAGGTGG - Intronic
938656831 2:133443136-133443158 AACCTGAACCCCTGAGGAAATGG - Intronic
939628839 2:144510942-144510964 TAGCTGAACCCCTGACACGGCGG - Intronic
941151169 2:161917488-161917510 GCCTTGAACCCCTGAGGTGGAGG + Intronic
941825977 2:169897580-169897602 GAACTGAACCCAGGAGGCGGAGG - Intronic
942040576 2:172058106-172058128 TAGCTGAACTCCTGAGTAGCTGG + Intronic
942098619 2:172556455-172556477 GGGCGGAAACGCTGAGGAGGAGG - Intronic
944141181 2:196458780-196458802 GACTTGAACCCAGGAGGAGGAGG + Intronic
944173363 2:196802869-196802891 CACCTGAACCCCGGAGGCGGAGG - Intergenic
945593021 2:211757618-211757640 GAGTTGAGCCCCTGAGGGAGGGG - Intronic
946342474 2:219079727-219079749 GAGCTGAACTCCTGAGAGTGAGG - Intronic
947523784 2:230866390-230866412 GACCTGGACCCTGGAGGAGGGGG + Intronic
947819146 2:233058749-233058771 GAGATGACCCCATAAGGAGGGGG + Intergenic
948053327 2:234994196-234994218 GAGTTGAAGCCCTGAGAGGGGGG + Intronic
948872654 2:240811520-240811542 CAGCTGAACCCCTGAGAAGGCGG + Intronic
948904034 2:240969355-240969377 GCCCTGAGCCTCTGAGGAGGTGG + Intronic
1169465155 20:5831294-5831316 GAGTTGACCCCCAAAGGAGGTGG - Intronic
1171294576 20:24006122-24006144 GAGCGCAATCACTGAGGAGGTGG + Intergenic
1171448836 20:25222468-25222490 GTGCAGGCCCCCTGAGGAGGTGG + Intronic
1173319249 20:41972730-41972752 GACCTCAAGCCCTAAGGAGGCGG - Intergenic
1174041380 20:47702362-47702384 GAGATGAAAAACTGAGGAGGAGG + Intronic
1174754318 20:53142687-53142709 GAGCTGAACTACTGAGGGTGTGG + Intronic
1175082292 20:56430761-56430783 GAGCTGAGACCCAGAGGAGGAGG + Intronic
1175941781 20:62540674-62540696 GGCCTGCACCCCCGAGGAGGAGG + Intergenic
1175952658 20:62591558-62591580 GAGCTGAGCCCCAGTGGAAGCGG + Intergenic
1175980428 20:62735901-62735923 GTGCTGAACCCGTGAGGAATTGG - Intronic
1178432496 21:32528957-32528979 AAGCTGAACCCAGGAGGCGGAGG + Intergenic
1178762092 21:35412736-35412758 GAGCAGATCCTCTGTGGAGGAGG + Intronic
1179995724 21:44973280-44973302 GAGCTGAACCCCTGAGGAGGTGG - Intronic
1180994685 22:19959630-19959652 GAACTGAAGCCCTGAGCAGAGGG - Intronic
1181661494 22:24353490-24353512 GAGTTGAACCCAGGAGGCGGAGG - Intronic
1182352609 22:29707219-29707241 GAGCCGAGCTCCTGGGGAGGGGG - Intergenic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183257464 22:36771577-36771599 GATCCGGACCCCTGAGGAAGGGG - Intronic
1183508546 22:38222269-38222291 GCTCTGAGCCCCTGAGGATGGGG - Intronic
1183578974 22:38711757-38711779 CACCTGAACCCCGGAGGTGGAGG + Intronic
1183715681 22:39532330-39532352 GACCTGCGCCCCAGAGGAGGTGG - Intronic
1183970773 22:41475812-41475834 CAGCTGAACCCAGGAGGTGGAGG + Intronic
1184205188 22:42997795-42997817 CATCTGAACCCGTGAGGTGGAGG + Intronic
1184890174 22:47374526-47374548 GGGCTGGAGCTCTGAGGAGGCGG - Intergenic
1184934870 22:47713956-47713978 AAGCTGAACCCATGAGAAGGGGG + Intergenic
1184991728 22:48174906-48174928 GAGCTGACTCCATGAGGAGGCGG - Intergenic
1185012349 22:48321260-48321282 AGGCTGAACCCCTAGGGAGGAGG - Intergenic
949535355 3:4991446-4991468 CAGTTGAACCCGAGAGGAGGAGG + Intergenic
949543570 3:5053386-5053408 GAGCTACACCCCTGAGGATATGG + Intergenic
950069069 3:10137212-10137234 GACATGAACCCCGGAGGTGGAGG + Intergenic
952729114 3:36620496-36620518 GAGCAGAACCTCTGAGGACAGGG + Intergenic
952827585 3:37537146-37537168 GACCTGAACCTCTGAGGAGGGGG + Intronic
952906593 3:38143134-38143156 GGACTGAACCTGTGAGGAGGGGG - Intergenic
953923939 3:46971173-46971195 GAGCTGAGCCACGGAGGATGGGG - Intronic
954964365 3:54597265-54597287 GTGCTGAGGCCCTAAGGAGGTGG - Intronic
955534576 3:59909411-59909433 CACTTGAACCCCAGAGGAGGAGG - Intronic
957214938 3:77307797-77307819 CACTTGAACCCCTGAGGTGGTGG + Intronic
957301114 3:78392077-78392099 TACCTGAACCCGGGAGGAGGAGG + Intergenic
958410256 3:93807512-93807534 GAGCTGCACTCCTTTGGAGGAGG + Intergenic
959443278 3:106406021-106406043 TGCCTGAACCCCGGAGGAGGAGG - Intergenic
959694504 3:109234659-109234681 GGCCTGAACCCCTAAGGGGGAGG + Intergenic
959910751 3:111761099-111761121 CACCTGAACCCCGGAGGTGGAGG + Intronic
962713139 3:138103988-138104010 GAGCTGACCACCAGAGGAGGGGG + Exonic
965743678 3:171903045-171903067 GAGCTGAGGCCTTGAGGAGCAGG - Intronic
968817738 4:2830443-2830465 CACCTGAACCCCGGAGGTGGAGG - Intronic
968849484 4:3069227-3069249 GGCCTGAACCCAAGAGGAGGAGG - Intergenic
969298056 4:6281142-6281164 GAGCAGGAGCCCTGGGGAGGAGG + Intronic
969338598 4:6526867-6526889 GGCCTGATTCCCTGAGGAGGGGG + Intronic
969362987 4:6676996-6677018 GAGCTGACCATCTGAGGTGGTGG + Intergenic
969677264 4:8620988-8621010 CAGCTGAAGCCCAGAGGAGCAGG + Intergenic
969677678 4:8623350-8623372 CAGCTGAGACCCTGAGGAGTGGG + Intergenic
969678216 4:8626626-8626648 CAGCTGAAGCCCAGAGGAGCAGG + Intergenic
969678633 4:8628991-8629013 CAGCTGAGACCCTGAGGAGTGGG + Intergenic
969679172 4:8632264-8632286 CAGCTGAAGCCCAGAGGAGCAGG + Intergenic
969679589 4:8634629-8634651 CAGCTGAGACCCTGAGGAGTGGG + Intergenic
971884681 4:32428123-32428145 CACTTGAACCCATGAGGAGGAGG + Intergenic
971902411 4:32679375-32679397 GAGCAGAGCCCTGGAGGAGGAGG - Intergenic
972315003 4:37917955-37917977 AAGATGATCCCCTGAGGAGCTGG + Intronic
973905922 4:55530689-55530711 CAGCTGAACCCAGGAGGTGGAGG + Intronic
978375256 4:108068320-108068342 GAGCTAATCCACTCAGGAGGAGG + Intronic
979262628 4:118666122-118666144 GGGTTGAACCCATGAGGTGGAGG + Intergenic
983939809 4:173527269-173527291 GAGCTCAAGCAGTGAGGAGGAGG - Exonic
985075208 4:186207323-186207345 GACATGAACCCCTCAGGGGGCGG + Intronic
985780505 5:1868466-1868488 GAGCTGAGGCCCTGACGAAGTGG - Intergenic
986272203 5:6243143-6243165 GAGCTGAAGCCCTTAAGAGTTGG - Intergenic
986316995 5:6596093-6596115 GACATGAACCCCAGAGGCGGGGG + Intergenic
986641992 5:9880976-9880998 GGACTGAGCCCCTGGGGAGGAGG + Intergenic
987693406 5:21297636-21297658 CACTTGAACCCATGAGGAGGAGG - Intergenic
988514777 5:31894971-31894993 CAGCTGAACCCAGGAGGCGGAGG - Intronic
989674161 5:43953966-43953988 GAGCTGCATTCCTGTGGAGGAGG - Intergenic
989679796 5:44014872-44014894 GAGCTGCATTCCTGTGGAGGAGG - Intergenic
990477261 5:56173626-56173648 CACCTGAACCCAGGAGGAGGCGG - Intronic
991311680 5:65249988-65250010 GAGATGAAGCCCTTGGGAGGTGG - Intronic
991460951 5:66858038-66858060 CAGTTGAACCCAGGAGGAGGAGG - Intronic
991512840 5:67398990-67399012 GACCTGAACCCAGGAGGTGGAGG - Intergenic
991746866 5:69751909-69751931 CACTTGAACCCATGAGGAGGAGG + Intergenic
991750839 5:69803333-69803355 CACTTGAACCCATGAGGAGGAGG - Intergenic
991798468 5:70331854-70331876 CACTTGAACCCATGAGGAGGAGG + Intergenic
991826244 5:70627222-70627244 CACTTGAACCCATGAGGAGGAGG + Intergenic
991830127 5:70678228-70678250 CACTTGAACCCATGAGGAGGAGG - Intergenic
991890800 5:71331169-71331191 CACTTGAACCCATGAGGAGGAGG + Intergenic
992789547 5:80201251-80201273 CAGCTGAACAAGTGAGGAGGTGG - Intronic
995759897 5:115551989-115552011 GAGCTAAGCATCTGAGGAGGTGG - Intergenic
996748328 5:126865057-126865079 GGACTGAACCCCGGAGGTGGAGG + Intergenic
997989915 5:138535789-138535811 GAGCTGAACCTGGGAGGTGGAGG + Intronic
1001365188 5:171130518-171130540 CGCCTGAACCCCAGAGGAGGAGG - Intronic
1002423708 5:179163892-179163914 GAGGAGACTCCCTGAGGAGGGGG + Intronic
1002650108 5:180684928-180684950 GAGCAGGGGCCCTGAGGAGGAGG + Intergenic
1002803997 6:554123-554145 GGGTTGAACCCAGGAGGAGGAGG - Intronic
1003073609 6:2963844-2963866 CAGATGAGCCCCTGAGGAGAGGG - Intronic
1004743981 6:18491677-18491699 GAGCTGAGCCCCTGTGGAGGGGG - Intergenic
1005319154 6:24635187-24635209 GAGGTGAACCCAGGAGGTGGAGG - Intronic
1005557503 6:27002299-27002321 CACTTGAACCCATGAGGAGGAGG + Intergenic
1007147190 6:39647788-39647810 GAACTGAACCCGGGAGGCGGAGG - Intronic
1008576169 6:52861911-52861933 GAGCTGCGCCCCTTTGGAGGAGG - Intronic
1009273595 6:61646901-61646923 TACTTGAACCCCGGAGGAGGAGG - Intergenic
1012368538 6:98473094-98473116 CACTTGAACCCCTGAGGTGGAGG + Intergenic
1012524750 6:100164084-100164106 GAACTGGACCACTGAGGAAGAGG - Intergenic
1012753837 6:103198693-103198715 TGGCTGAACCCGGGAGGAGGAGG - Intergenic
1013226915 6:108125940-108125962 GAGTTGAACCCAGGAGGAAGAGG - Intronic
1013383689 6:109603116-109603138 GAGCTGCATCCCTTTGGAGGGGG + Intronic
1016622339 6:146126893-146126915 GAGCTGAGCCTCTCAGGAGTAGG + Intronic
1017071351 6:150577690-150577712 GATCTGAACCCTGGAGGTGGAGG + Intergenic
1017526694 6:155247410-155247432 CACCTGAACTCCTGAGGTGGAGG - Intronic
1017534681 6:155334239-155334261 AGGCTGAACCCTTGAGGTGGAGG - Intergenic
1017949272 6:159122264-159122286 CACCTGAACCCCGGAGGTGGAGG - Intergenic
1018715640 6:166530498-166530520 AAACTGACCCCCTGGGGAGGAGG - Intronic
1019412935 7:914462-914484 GCGCTGGAGCCCTGTGGAGGAGG + Intronic
1019501765 7:1368427-1368449 GGGCTGAGGCCCTGGGGAGGGGG - Intergenic
1019743447 7:2687241-2687263 GACTTGAACCCCGGAGGTGGAGG + Intronic
1020618469 7:10489855-10489877 GACTTGAACCCCAGAGGCGGAGG - Intergenic
1020651544 7:10882476-10882498 GAGAGGAAACCCTGAGGGGGTGG - Intergenic
1021899041 7:25264735-25264757 CAGCAGAACCCATGAGGAGAAGG + Intergenic
1021927937 7:25551371-25551393 GAACTGAACCCTGGAGGAGGGGG + Intergenic
1022150121 7:27594225-27594247 CAGTTGAACCCAGGAGGAGGAGG - Intronic
1023811503 7:43915663-43915685 GAGCTGGACCCCTCAGCAGGAGG - Intronic
1024695102 7:51847762-51847784 GAGCAGAACACCTGAGGATGGGG - Intergenic
1025731521 7:64112813-64112835 CACCTGAACCCCAGAGGTGGAGG + Intronic
1025928327 7:65976407-65976429 CACCTGAACCCCAGAGGTGGAGG - Intronic
1026033817 7:66816723-66816745 GAGGGGAATCGCTGAGGAGGCGG + Intergenic
1026189682 7:68113313-68113335 CACCTGAACCCGGGAGGAGGAGG + Intergenic
1026353179 7:69535111-69535133 CAGCTGAACCCAGGAGGCGGAGG + Intergenic
1026529140 7:71182089-71182111 CACTTGAACCCCAGAGGAGGAGG + Intronic
1027110217 7:75432099-75432121 TAGCTGAACCCAGGAGGTGGAGG + Intronic
1028509019 7:91601620-91601642 CACTTGAACCCCAGAGGAGGAGG - Intergenic
1029179563 7:98690221-98690243 CACCTGAACCCCTGAAGAAGAGG - Intergenic
1030263840 7:107595298-107595320 GAGCTAAACCCCTGAGGGCATGG + Intronic
1031025288 7:116672614-116672636 AAGCAGAACCCCTGAGGCGAGGG - Intronic
1032594047 7:133221534-133221556 CAGCTGAACCCAGGAGGTGGAGG + Intergenic
1032781216 7:135166658-135166680 TAGCAGGAGCCCTGAGGAGGAGG - Exonic
1033048191 7:137981132-137981154 GAGTTAAAGCCCAGAGGAGGAGG + Intronic
1033135111 7:138777529-138777551 TAGCTGAACCCGGAAGGAGGAGG + Intronic
1033523848 7:142190353-142190375 CACCTGAACCCAGGAGGAGGAGG - Intronic
1033674895 7:143531183-143531205 GAGCTGAACTACTATGGAGGAGG + Intergenic
1033696941 7:143798257-143798279 GAGCTGAACTACTATGGAGGAGG - Intergenic
1034453071 7:151148294-151148316 GAGGTGGACTCCTGGGGAGGGGG - Intergenic
1035212047 7:157336222-157336244 AACCAGAACCCCTGAGGACGCGG + Intronic
1035231477 7:157468533-157468555 GAGCTGATCCCCTGGTGAGTGGG + Intergenic
1035394997 7:158528952-158528974 GGGCTGGCCCCCTGAGGAGCTGG - Intronic
1036162977 8:6406485-6406507 GAGCTGAGCCCCCGGGGAGGGGG - Intergenic
1036599136 8:10242960-10242982 GAAATGACCCCATGAGGAGGAGG - Intronic
1038781112 8:30569079-30569101 TAGCTGCAGCCCTGATGAGGGGG - Intronic
1039388301 8:37156480-37156502 GAACTGAACTCCAGAGGAGCTGG + Intergenic
1039502359 8:38028132-38028154 GACCTGAGCCCCAGAGGTGGAGG - Intergenic
1039719084 8:40143241-40143263 GAGCTGCACTCCTTTGGAGGAGG + Intergenic
1041054651 8:53971525-53971547 AACTTGAACCCCTGAGGCGGAGG + Intronic
1045343236 8:101272649-101272671 GAGCTGGAGGCCTGAGGAGCAGG - Intergenic
1045522507 8:102915441-102915463 GAGCTGAAGCCCAGAGGAAGGGG - Intronic
1046179026 8:110618503-110618525 GAGTTGAACCCAGGAGGCGGAGG - Intergenic
1047650575 8:126915896-126915918 CACCTGAACCCAGGAGGAGGAGG - Intergenic
1047896725 8:129374500-129374522 GAGCCAAACACCTTAGGAGGTGG + Intergenic
1048546869 8:135395701-135395723 CACCTGAACCCCAGAGGCGGAGG - Intergenic
1049438418 8:142598234-142598256 CAGGTGAACCCCAGAGGAGGAGG - Intergenic
1049555809 8:143281435-143281457 GAACTAAACCCCTAAGGAGAGGG + Intergenic
1049715201 8:144086562-144086584 GAGCTGGAGCCCTGCAGAGGAGG + Intergenic
1049756649 8:144313834-144313856 GGGCTGAACAGCTGCGGAGGAGG - Exonic
1051330557 9:16021169-16021191 CACCTGAACCCCGGAGGCGGAGG - Intronic
1053135323 9:35647090-35647112 GAGCTTTACCCTGGAGGAGGCGG - Intergenic
1054720885 9:68602619-68602641 GGGCTGCACCTCTCAGGAGGAGG - Intergenic
1055306191 9:74931200-74931222 GATTTGAACCCAGGAGGAGGAGG + Intergenic
1057620483 9:96630224-96630246 TAGCTGAACCCAGGAGGCGGAGG + Intergenic
1058471079 9:105279399-105279421 CAGCTGAACCCGGGAGGCGGAGG - Intronic
1059307165 9:113362914-113362936 GAGCTGAGGGCCTGAGGAAGTGG + Intronic
1060153686 9:121304322-121304344 GAGCTGGACACCTCAGCAGGAGG - Intronic
1060209110 9:121699501-121699523 GGGCTGCGCCCCTGAGGACGCGG + Intronic
1060593281 9:124832841-124832863 GGCCAGGACCCCTGAGGAGGTGG - Intergenic
1061208968 9:129179684-129179706 CAGAAGATCCCCTGAGGAGGCGG - Intergenic
1062068376 9:134540961-134540983 GAGCCGGAACCCAGAGGAGGGGG + Intergenic
1062599484 9:137313485-137313507 GACATGACCCCCTGAGAAGGTGG + Intronic
1062681699 9:137785413-137785435 GTGCTGAGCCCCTGAGGGTGGGG + Intronic
1185755784 X:2652016-2652038 GACCTGAACCCGGGAGGCGGAGG - Intergenic
1186495725 X:10011851-10011873 GAGCTGAACCAGAGAGGAAGAGG - Intergenic
1188035971 X:25317974-25317996 GAGCTGCATTCCTTAGGAGGAGG + Intergenic
1189062569 X:37769692-37769714 GAGCTGCATCCCTTTGGAGGGGG - Intronic
1189939355 X:46104943-46104965 GAGCTGCATCCCTTTGGAGGAGG - Intergenic
1190263720 X:48815488-48815510 GAGGTGAGCCCCGGTGGAGGAGG + Exonic
1190633993 X:52416964-52416986 GAGCAGAGCCCCTGAGAAGGTGG + Intergenic
1190637923 X:52454790-52454812 GAGCGGAGCCCCTGAGAAGGTGG - Intergenic
1190639928 X:52474570-52474592 GAGCAGAACTCCTGAAAAGGTGG - Intergenic
1190647744 X:52538295-52538317 GAGCAGAACTCCTGAAAAGGTGG + Intergenic
1190678730 X:52805670-52805692 GAGCAGAGCCCCTGAGAAGGTGG + Intergenic
1190691956 X:52919835-52919857 GAGCAAAGCCCCTGAGAAGGTGG + Intergenic
1190694027 X:52935957-52935979 GAGCAAAGCCCCTGAGAAGGTGG - Intronic
1191846152 X:65549688-65549710 GAGCTGAGCCCCTGAGAGGAGGG - Intergenic
1193785591 X:85756756-85756778 GAGCTGCATTCCTGTGGAGGAGG + Intergenic
1194059840 X:89182882-89182904 GAGCTGGACCCCTGGGCTGGAGG + Intergenic
1196901660 X:120390117-120390139 GAGCTGCATTCCTGTGGAGGAGG + Intergenic
1197780232 X:130151953-130151975 CACCTGAACCCCTGAGGTGGCGG + Intronic
1199151404 X:144490834-144490856 AAGCTGAGCACCTGAGGAGCTGG + Intergenic
1200159872 X:154001105-154001127 AAGCTGAACCCGGGAGGTGGAGG - Intergenic
1201018580 Y:9628338-9628360 TAGTTGAACCCATGAGGTGGAGG + Intergenic
1201522146 Y:14887576-14887598 GAGCTGCACTCCTTTGGAGGAGG + Intergenic