ID: 1179997236

View in Genome Browser
Species Human (GRCh38)
Location 21:44979661-44979683
Sequence GCCACGGATAACCCCACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179997236_1179997240 12 Left 1179997236 21:44979661-44979683 CCAAGTGTGGGGTTATCCGTGGC No data
Right 1179997240 21:44979696-44979718 GCTCCTGGCCACCATTGAGAGGG No data
1179997236_1179997246 25 Left 1179997236 21:44979661-44979683 CCAAGTGTGGGGTTATCCGTGGC No data
Right 1179997246 21:44979709-44979731 ATTGAGAGGGAGGCTCCAGGCGG No data
1179997236_1179997242 15 Left 1179997236 21:44979661-44979683 CCAAGTGTGGGGTTATCCGTGGC No data
Right 1179997242 21:44979699-44979721 CCTGGCCACCATTGAGAGGGAGG No data
1179997236_1179997238 -3 Left 1179997236 21:44979661-44979683 CCAAGTGTGGGGTTATCCGTGGC No data
Right 1179997238 21:44979681-44979703 GGCTGTCAGCTGAGCGCTCCTGG No data
1179997236_1179997239 11 Left 1179997236 21:44979661-44979683 CCAAGTGTGGGGTTATCCGTGGC No data
Right 1179997239 21:44979695-44979717 CGCTCCTGGCCACCATTGAGAGG No data
1179997236_1179997247 28 Left 1179997236 21:44979661-44979683 CCAAGTGTGGGGTTATCCGTGGC No data
Right 1179997247 21:44979712-44979734 GAGAGGGAGGCTCCAGGCGGAGG No data
1179997236_1179997244 22 Left 1179997236 21:44979661-44979683 CCAAGTGTGGGGTTATCCGTGGC No data
Right 1179997244 21:44979706-44979728 ACCATTGAGAGGGAGGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179997236 Original CRISPR GCCACGGATAACCCCACACT TGG (reversed) Intergenic
No off target data available for this crispr