ID: 1180000196

View in Genome Browser
Species Human (GRCh38)
Location 21:44992134-44992156
Sequence AGGCCACAGCGGGCACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180000191_1180000196 -7 Left 1180000191 21:44992118-44992140 CCACAGCCGCGTCTCCAGGCCAC No data
Right 1180000196 21:44992134-44992156 AGGCCACAGCGGGCACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180000196 Original CRISPR AGGCCACAGCGGGCACCTGC AGG Intergenic
No off target data available for this crispr