ID: 1180000704

View in Genome Browser
Species Human (GRCh38)
Location 21:44994085-44994107
Sequence AGTCTTGGTCGGCTGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180000693_1180000704 23 Left 1180000693 21:44994039-44994061 CCACAGGCTGCTGAGGGAGGACA 0: 1
1: 0
2: 5
3: 57
4: 1201
Right 1180000704 21:44994085-44994107 AGTCTTGGTCGGCTGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180000704 Original CRISPR AGTCTTGGTCGGCTGGCAGA GGG Intergenic