ID: 1180002081

View in Genome Browser
Species Human (GRCh38)
Location 21:44999738-44999760
Sequence CTGTGTTGGTGGCAGGTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180002070_1180002081 11 Left 1180002070 21:44999704-44999726 CCGGGGCAGGGGCCTCCAGGATG No data
Right 1180002081 21:44999738-44999760 CTGTGTTGGTGGCAGGTGGCCGG No data
1180002076_1180002081 -4 Left 1180002076 21:44999719-44999741 CCAGGATGGAGAGGCTGGGCTGT No data
Right 1180002081 21:44999738-44999760 CTGTGTTGGTGGCAGGTGGCCGG No data
1180002069_1180002081 12 Left 1180002069 21:44999703-44999725 CCCGGGGCAGGGGCCTCCAGGAT No data
Right 1180002081 21:44999738-44999760 CTGTGTTGGTGGCAGGTGGCCGG No data
1180002075_1180002081 -1 Left 1180002075 21:44999716-44999738 CCTCCAGGATGGAGAGGCTGGGC No data
Right 1180002081 21:44999738-44999760 CTGTGTTGGTGGCAGGTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180002081 Original CRISPR CTGTGTTGGTGGCAGGTGGC CGG Intergenic
No off target data available for this crispr