ID: 1180004490

View in Genome Browser
Species Human (GRCh38)
Location 21:45013884-45013906
Sequence GGGTGTTCCCAGAACTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180004487_1180004490 -3 Left 1180004487 21:45013864-45013886 CCAGTTTTTACTCCAAACATGGG No data
Right 1180004490 21:45013884-45013906 GGGTGTTCCCAGAACTGTCCTGG No data
1180004485_1180004490 0 Left 1180004485 21:45013861-45013883 CCACCAGTTTTTACTCCAAACAT No data
Right 1180004490 21:45013884-45013906 GGGTGTTCCCAGAACTGTCCTGG No data
1180004484_1180004490 1 Left 1180004484 21:45013860-45013882 CCCACCAGTTTTTACTCCAAACA No data
Right 1180004490 21:45013884-45013906 GGGTGTTCCCAGAACTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180004490 Original CRISPR GGGTGTTCCCAGAACTGTCC TGG Intergenic
No off target data available for this crispr