ID: 1180004640

View in Genome Browser
Species Human (GRCh38)
Location 21:45014660-45014682
Sequence CTCTCTCGGCTCCCCTGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180004640_1180004652 17 Left 1180004640 21:45014660-45014682 CCGGGCCAGGGGAGCCGAGAGAG No data
Right 1180004652 21:45014700-45014722 GAGGCAGGAAACAGTGTGCCAGG No data
1180004640_1180004654 25 Left 1180004640 21:45014660-45014682 CCGGGCCAGGGGAGCCGAGAGAG No data
Right 1180004654 21:45014708-45014730 AAACAGTGTGCCAGGCCCCTGGG No data
1180004640_1180004646 -10 Left 1180004640 21:45014660-45014682 CCGGGCCAGGGGAGCCGAGAGAG No data
Right 1180004646 21:45014673-45014695 GCCGAGAGAGGTGCGGCGAGGGG No data
1180004640_1180004651 2 Left 1180004640 21:45014660-45014682 CCGGGCCAGGGGAGCCGAGAGAG No data
Right 1180004651 21:45014685-45014707 GCGGCGAGGGGCAGGGAGGCAGG No data
1180004640_1180004650 -2 Left 1180004640 21:45014660-45014682 CCGGGCCAGGGGAGCCGAGAGAG No data
Right 1180004650 21:45014681-45014703 AGGTGCGGCGAGGGGCAGGGAGG No data
1180004640_1180004649 -5 Left 1180004640 21:45014660-45014682 CCGGGCCAGGGGAGCCGAGAGAG No data
Right 1180004649 21:45014678-45014700 GAGAGGTGCGGCGAGGGGCAGGG No data
1180004640_1180004648 -6 Left 1180004640 21:45014660-45014682 CCGGGCCAGGGGAGCCGAGAGAG No data
Right 1180004648 21:45014677-45014699 AGAGAGGTGCGGCGAGGGGCAGG No data
1180004640_1180004653 24 Left 1180004640 21:45014660-45014682 CCGGGCCAGGGGAGCCGAGAGAG No data
Right 1180004653 21:45014707-45014729 GAAACAGTGTGCCAGGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180004640 Original CRISPR CTCTCTCGGCTCCCCTGGCC CGG (reversed) Intergenic
No off target data available for this crispr