ID: 1180005585

View in Genome Browser
Species Human (GRCh38)
Location 21:45019034-45019056
Sequence CCTCCAGGACCCCGCGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180005585_1180005593 10 Left 1180005585 21:45019034-45019056 CCTCCCGCGCGGGGTCCTGGAGG No data
Right 1180005593 21:45019067-45019089 CGCTCCCTGCAGGCGACCCTGGG No data
1180005585_1180005592 9 Left 1180005585 21:45019034-45019056 CCTCCCGCGCGGGGTCCTGGAGG No data
Right 1180005592 21:45019066-45019088 GCGCTCCCTGCAGGCGACCCTGG No data
1180005585_1180005598 26 Left 1180005585 21:45019034-45019056 CCTCCCGCGCGGGGTCCTGGAGG No data
Right 1180005598 21:45019083-45019105 CCCTGGGGCGCGTCTGTCCCAGG No data
1180005585_1180005591 0 Left 1180005585 21:45019034-45019056 CCTCCCGCGCGGGGTCCTGGAGG No data
Right 1180005591 21:45019057-45019079 TCGCGGCACGCGCTCCCTGCAGG No data
1180005585_1180005594 11 Left 1180005585 21:45019034-45019056 CCTCCCGCGCGGGGTCCTGGAGG No data
Right 1180005594 21:45019068-45019090 GCTCCCTGCAGGCGACCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180005585 Original CRISPR CCTCCAGGACCCCGCGCGGG AGG (reversed) Intergenic
No off target data available for this crispr