ID: 1180005948

View in Genome Browser
Species Human (GRCh38)
Location 21:45020611-45020633
Sequence GATGACTTACACTCAAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180005938_1180005948 21 Left 1180005938 21:45020567-45020589 CCTGCCTTCTCTTTCCGGCGGGT No data
Right 1180005948 21:45020611-45020633 GATGACTTACACTCAAATCCTGG No data
1180005944_1180005948 -9 Left 1180005944 21:45020597-45020619 CCACCTCCCAGATAGATGACTTA No data
Right 1180005948 21:45020611-45020633 GATGACTTACACTCAAATCCTGG No data
1180005942_1180005948 7 Left 1180005942 21:45020581-45020603 CCGGCGGGTCCTGGGACCACCTC No data
Right 1180005948 21:45020611-45020633 GATGACTTACACTCAAATCCTGG No data
1180005943_1180005948 -2 Left 1180005943 21:45020590-45020612 CCTGGGACCACCTCCCAGATAGA No data
Right 1180005948 21:45020611-45020633 GATGACTTACACTCAAATCCTGG No data
1180005934_1180005948 27 Left 1180005934 21:45020561-45020583 CCACTGCCTGCCTTCTCTTTCCG No data
Right 1180005948 21:45020611-45020633 GATGACTTACACTCAAATCCTGG No data
1180005939_1180005948 17 Left 1180005939 21:45020571-45020593 CCTTCTCTTTCCGGCGGGTCCTG No data
Right 1180005948 21:45020611-45020633 GATGACTTACACTCAAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180005948 Original CRISPR GATGACTTACACTCAAATCC TGG Intergenic
No off target data available for this crispr