ID: 1180011036

View in Genome Browser
Species Human (GRCh38)
Location 21:45051698-45051720
Sequence CCTCACATGCAGAGGGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180011036_1180011048 21 Left 1180011036 21:45051698-45051720 CCAGCTACCCTCTGCATGTGAGG No data
Right 1180011048 21:45051742-45051764 GTGTGCCTGCTGGTGCAGCAGGG No data
1180011036_1180011050 26 Left 1180011036 21:45051698-45051720 CCAGCTACCCTCTGCATGTGAGG No data
Right 1180011050 21:45051747-45051769 CCTGCTGGTGCAGCAGGGACAGG No data
1180011036_1180011044 -7 Left 1180011036 21:45051698-45051720 CCAGCTACCCTCTGCATGTGAGG No data
Right 1180011044 21:45051714-45051736 TGTGAGGGGCAGTGGGCCTGTGG No data
1180011036_1180011047 20 Left 1180011036 21:45051698-45051720 CCAGCTACCCTCTGCATGTGAGG No data
Right 1180011047 21:45051741-45051763 AGTGTGCCTGCTGGTGCAGCAGG No data
1180011036_1180011051 30 Left 1180011036 21:45051698-45051720 CCAGCTACCCTCTGCATGTGAGG No data
Right 1180011051 21:45051751-45051773 CTGGTGCAGCAGGGACAGGCTGG No data
1180011036_1180011046 11 Left 1180011036 21:45051698-45051720 CCAGCTACCCTCTGCATGTGAGG No data
Right 1180011046 21:45051732-45051754 TGTGGCTCGAGTGTGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180011036 Original CRISPR CCTCACATGCAGAGGGTAGC TGG (reversed) Intergenic
No off target data available for this crispr