ID: 1180013155

View in Genome Browser
Species Human (GRCh38)
Location 21:45064670-45064692
Sequence TCTAGAAAACAAAAATAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180013152_1180013155 -4 Left 1180013152 21:45064651-45064673 CCAAAAATAGAAGTGGAATTCTA No data
Right 1180013155 21:45064670-45064692 TCTAGAAAACAAAAATAGGTGGG No data
1180013151_1180013155 -1 Left 1180013151 21:45064648-45064670 CCACCAAAAATAGAAGTGGAATT No data
Right 1180013155 21:45064670-45064692 TCTAGAAAACAAAAATAGGTGGG No data
1180013149_1180013155 30 Left 1180013149 21:45064617-45064639 CCACTTTGGGAAATAGTCAAACT No data
Right 1180013155 21:45064670-45064692 TCTAGAAAACAAAAATAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180013155 Original CRISPR TCTAGAAAACAAAAATAGGT GGG Intergenic
No off target data available for this crispr