ID: 1180013963

View in Genome Browser
Species Human (GRCh38)
Location 21:45071037-45071059
Sequence GGTCTTGGTCCTGGTGTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 278}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180013963_1180013970 5 Left 1180013963 21:45071037-45071059 CCTAGGACACCAGGACCAAGACC 0: 1
1: 0
2: 2
3: 19
4: 278
Right 1180013970 21:45071065-45071087 ACAGTCTCAGCACAGCAGGTTGG 0: 1
1: 0
2: 2
3: 19
4: 170
1180013963_1180013968 1 Left 1180013963 21:45071037-45071059 CCTAGGACACCAGGACCAAGACC 0: 1
1: 0
2: 2
3: 19
4: 278
Right 1180013968 21:45071061-45071083 GGCCACAGTCTCAGCACAGCAGG 0: 1
1: 0
2: 1
3: 29
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180013963 Original CRISPR GGTCTTGGTCCTGGTGTCCT AGG (reversed) Intergenic