ID: 1180013963 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:45071037-45071059 |
| Sequence | GGTCTTGGTCCTGGTGTCCT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 300 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 19, 4: 278} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1180013963_1180013970 | 5 | Left | 1180013963 | 21:45071037-45071059 | CCTAGGACACCAGGACCAAGACC | 0: 1 1: 0 2: 2 3: 19 4: 278 |
||
| Right | 1180013970 | 21:45071065-45071087 | ACAGTCTCAGCACAGCAGGTTGG | 0: 1 1: 0 2: 2 3: 19 4: 170 |
||||
| 1180013963_1180013968 | 1 | Left | 1180013963 | 21:45071037-45071059 | CCTAGGACACCAGGACCAAGACC | 0: 1 1: 0 2: 2 3: 19 4: 278 |
||
| Right | 1180013968 | 21:45071061-45071083 | GGCCACAGTCTCAGCACAGCAGG | 0: 1 1: 0 2: 1 3: 29 4: 277 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1180013963 | Original CRISPR | GGTCTTGGTCCTGGTGTCCT AGG (reversed) | Intergenic | ||