ID: 1180014081

View in Genome Browser
Species Human (GRCh38)
Location 21:45071737-45071759
Sequence CTGGAAAATAAACCTGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180014081_1180014085 17 Left 1180014081 21:45071737-45071759 CCAGCATCAGGTTTATTTTCCAG 0: 1
1: 0
2: 1
3: 15
4: 220
Right 1180014085 21:45071777-45071799 TTATTCCATAATTCCCACAAAGG 0: 1
1: 0
2: 3
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180014081 Original CRISPR CTGGAAAATAAACCTGATGC TGG (reversed) Intergenic
901861308 1:12076394-12076416 TTGGAGAATAAAACTGAGGCCGG - Intronic
901950882 1:12745243-12745265 CTTGAAACTAAGCCTGAGGCAGG - Intergenic
904792766 1:33036324-33036346 CTGGAATGTAACCCTGATTCTGG + Intronic
904957250 1:34295297-34295319 CAGGAAAATAAACCCGAGCCAGG - Intergenic
906445999 1:45898632-45898654 CTGGCAAATGAGACTGATGCCGG - Intronic
906832223 1:49045042-49045064 CAGGAAACTAAACCTGGAGCAGG + Intronic
909030819 1:70537472-70537494 CTGGAAGATTAACCTTATTCTGG + Intergenic
909328748 1:74386795-74386817 CTTCAAAATAAACATGATGAAGG + Intronic
911476582 1:98380853-98380875 CTGGAAAGGAAATCTGATCCTGG + Intergenic
911642774 1:100306530-100306552 CTGTACAATAAGCATGATGCTGG - Intergenic
911746252 1:101444983-101445005 CTGACAAGTAAAACTGATGCTGG - Intergenic
913177396 1:116287463-116287485 TTGGAAAATAAACCTGGTGAGGG - Intergenic
916177344 1:162053500-162053522 CTGGAAAAACAACCTGTTCCTGG - Intergenic
916606513 1:166347862-166347884 CTAAAAGATAAACCTGATGAGGG - Intergenic
917687685 1:177434184-177434206 CTGTTAATAAAACCTGATGCCGG + Intergenic
917777062 1:178349098-178349120 CATGAAAATAAACCTGGTGTCGG - Intronic
918241801 1:182626865-182626887 CTGGAAAATAAAACTGTAGATGG - Intergenic
918484740 1:185017194-185017216 CAGGAATAAAAAACTGATGCAGG - Intergenic
918848926 1:189657855-189657877 CTGGAAAACCTACCTGATGACGG - Intergenic
920530439 1:206698011-206698033 CTGGGAAAATAACCTGATGCTGG + Intronic
920833699 1:209488239-209488261 CTGCAAAACAGACCTGCTGCAGG + Intergenic
921738316 1:218654112-218654134 CAGGAAAACAAACCAGTTGCAGG + Intergenic
922098038 1:222459182-222459204 CTGTAAAGGAAACATGATGCTGG - Intergenic
922421816 1:225465548-225465570 CAGGAAAAGACATCTGATGCTGG - Intergenic
922976380 1:229787214-229787236 CTGGAGAATAAACCTGAGAGGGG + Intergenic
923736034 1:236608671-236608693 CTTGAAAATATATCTGTTGCTGG + Intergenic
924619073 1:245644834-245644856 CTGTAAAAGACACCTGAGGCTGG + Intronic
1062972730 10:1661147-1661169 TTGGAAAATAAACCTGAGAGGGG - Intronic
1064652242 10:17521192-17521214 CTGGAAAATAATACTGGAGCAGG - Intergenic
1065591232 10:27264167-27264189 GTGCAAAATAAACTTGAGGCTGG - Intergenic
1066444742 10:35471445-35471467 CTGGAAGGTAAACTTGGTGCTGG + Intronic
1066696599 10:38084592-38084614 CTGGGAGATCCACCTGATGCAGG + Intergenic
1067448093 10:46365179-46365201 CTGTAAAATTAAGCTGCTGCAGG + Intergenic
1067589287 10:47495582-47495604 CTGTAAAATTAAGCTGCTGCAGG - Intergenic
1067636412 10:48003664-48003686 CTGTAAAATTAAGCTGCTGCAGG - Intergenic
1067877072 10:50016654-50016676 CTGTAAAATTAAACTGCTGCAGG + Intergenic
1067910254 10:50339246-50339268 CTGGGAGAGAACCCTGATGCAGG - Intronic
1068813557 10:61283971-61283993 CTAGAAAATAAACTCCATGCAGG + Intergenic
1069563558 10:69448754-69448776 CTGGGAAGGAAACCTGATGGAGG + Intergenic
1069978678 10:72236897-72236919 CTGGACTTTAAAGCTGATGCTGG - Intergenic
1070043616 10:72807680-72807702 TCAGAAAATAGACCTGATGCTGG + Intronic
1070897624 10:79998399-79998421 CTGGAAAATATAGATGAGGCTGG - Intergenic
1071608701 10:87016396-87016418 CTGTAAAATTAAGCTGCTGCAGG + Intergenic
1071892609 10:90028105-90028127 TTGGAAAATAAACCTGAGTGGGG + Intergenic
1073700588 10:105922336-105922358 CTGGGAAATAAAATTGATACTGG + Intergenic
1074557699 10:114507338-114507360 CTGAAAAATAAATCTGAAGAAGG + Intronic
1075021499 10:118955924-118955946 GTGGAAAATAAACCTGGGACTGG + Intergenic
1075940538 10:126387634-126387656 CTGGAAAGGAAACCTGGTGAAGG + Intronic
1078183653 11:9032919-9032941 GTGGGAAATAAAGCTGAGGCTGG + Intronic
1078616768 11:12873086-12873108 CAGGAAAATGAACCTCATCCTGG - Intronic
1086764136 11:90674239-90674261 CAGCAAAATAATTCTGATGCAGG + Intergenic
1087799072 11:102484404-102484426 ATGGAAAATAATCGTGGTGCTGG + Intronic
1088833377 11:113557043-113557065 CTGGAACTTACAACTGATGCAGG + Intergenic
1089771629 11:120807322-120807344 CAGGAAATTAAACCTCAAGCTGG - Intronic
1089817788 11:121191816-121191838 CTTCAAAATAAACCTGAAGTGGG - Intergenic
1090264531 11:125345694-125345716 CTGGAAAAAAAAAGTGTTGCTGG - Intronic
1091896804 12:4111531-4111553 TTGCAAAATAAAAGTGATGCCGG - Intergenic
1094013748 12:25838828-25838850 CAGAAAAATAAAAATGATGCAGG - Intergenic
1095650871 12:44607578-44607600 CTTGAAAATAAACCTGAAAATGG + Intronic
1095785593 12:46105631-46105653 TTTGAAAAGAAACCTGAGGCTGG - Intergenic
1097858189 12:64489874-64489896 TTAAAAAAAAAACCTGATGCCGG - Intronic
1100472367 12:94904977-94904999 CTTGAAAATAACTCTGATGTAGG + Intronic
1102351446 12:112195157-112195179 CTGGAAGAGAAGCCTGAGGCAGG - Intronic
1102782714 12:115579275-115579297 CTGGATTATACACCTTATGCGGG + Intergenic
1105323303 13:19347556-19347578 GTGGAAAAGGAAACTGATGCAGG + Intergenic
1105874086 13:24538282-24538304 GTGGAAAAGGAAACTGATGCAGG - Intergenic
1106588382 13:31076900-31076922 CTGAAGAATAAAAGTGATGCGGG - Intergenic
1107831215 13:44374657-44374679 CTGGAAAGAAAACTTGATCCTGG - Intronic
1109243265 13:59918545-59918567 CACGAAAGTAAGCCTGATGCAGG + Intronic
1110901687 13:80833120-80833142 CTGTAAAATAAACCTGAGATTGG + Intergenic
1112295478 13:98182821-98182843 CTGGAAGAGAAAGCTGAGGCTGG + Intronic
1113662323 13:112116234-112116256 CTGAAAAAAAAGCATGATGCTGG + Intergenic
1115110505 14:29815750-29815772 CTGGAAAATAAACATGGGGCTGG - Intronic
1115137829 14:30132355-30132377 CAGGAAAATAAGCATGATTCTGG + Intronic
1116129372 14:40834906-40834928 CTGGAAAATAATCCTCATTTAGG + Intergenic
1116584546 14:46686287-46686309 CTGAAAAATACAACTGATGAAGG - Intergenic
1117273071 14:54164682-54164704 CTGGAGAATAACTCTGAGGCTGG - Intergenic
1119182058 14:72611983-72612005 CTGGAAAATAAACCGCATGCTGG - Intergenic
1122847548 14:104508303-104508325 CTGGAAAAGAAACATGATCCTGG + Intronic
1126603266 15:50450355-50450377 TTGGAAAAAAAAACTGATTCTGG + Intronic
1126839094 15:52698368-52698390 CTGGATCATAAAGCAGATGCAGG - Intronic
1127250033 15:57224647-57224669 CTGGAAAATAAACATGTCTCTGG + Intronic
1129910424 15:79221744-79221766 CAGGAAAATAGACCTGCTTCAGG - Intergenic
1130143950 15:81257683-81257705 CTGGAAAATGCACCAGGTGCTGG + Intronic
1133893494 16:9903606-9903628 GTGGCCAATAAGCCTGATGCAGG - Intronic
1134406640 16:13965245-13965267 CTGAAAAAGAAACCTGTTGCGGG - Intergenic
1135859467 16:26042322-26042344 CTACATAATAAAACTGATGCTGG + Intronic
1139815239 16:69664579-69664601 CTGAAAAATAAAGTTGAGGCCGG - Intronic
1140284854 16:73592581-73592603 CCTGAAAATAATCCTGAGGCAGG + Intergenic
1141826574 16:86484873-86484895 CTGGAAAGCAAAACTAATGCAGG - Intergenic
1142808815 17:2385856-2385878 CTGGAAACAAGACCAGATGCTGG + Exonic
1142921341 17:3189824-3189846 TTGGAAAATAAACCTGAGGGGGG + Intergenic
1143067238 17:4259841-4259863 CTGGAATATAAACCCCATGAGGG - Intronic
1144189857 17:12834692-12834714 CTAGAAAATAAACTTCATGGGGG - Intronic
1146146711 17:30425216-30425238 CTGGAAGTTTAACCTGATGGAGG - Intronic
1147706327 17:42427430-42427452 CTGGAAAAGAAACTAGTTGCTGG - Intergenic
1151471102 17:74318299-74318321 GTGGAGAATAAACCAGATGCAGG + Intergenic
1151832058 17:76558884-76558906 CTGGAGAATAAACCTTAAGGTGG + Intergenic
1159208235 18:65281590-65281612 TTGGAGAATAAACCTGAGGGGGG - Intergenic
1159326225 18:66922835-66922857 CTGTAATATAAAGCTCATGCTGG + Intergenic
1159539383 18:69755982-69756004 CAGGAAATCACACCTGATGCAGG - Intronic
1159981289 18:74783942-74783964 CTGGAAAATTATACTGCTGCTGG - Intronic
1163709143 19:18835288-18835310 CAGGAAAATGAACCTGATCGAGG + Intronic
1165604105 19:37085348-37085370 CATCAAAATAAACCAGATGCTGG - Intronic
1166539133 19:43594121-43594143 CTTGAAAACAAAACTGATGGTGG + Intronic
1167733485 19:51276406-51276428 CTGGAAGATGAACGTGATGCTGG - Intergenic
925312549 2:2896130-2896152 CTGTACAAGAAGCCTGATGCTGG + Intergenic
926028870 2:9568343-9568365 CTGCAAAATAAATCTTTTGCAGG + Intergenic
926659859 2:15452769-15452791 CTGGAAAGGAAACCTGTTGTTGG - Intronic
927594228 2:24382763-24382785 CTGAAAAATAAACCGCATGAAGG - Intergenic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
930226209 2:48796553-48796575 CTGGAAAAACAACCTCGTGCAGG - Intergenic
930389530 2:50743543-50743565 CTGGAAAACAAAATTGATGTGGG - Intronic
930933565 2:56919045-56919067 CAGGCAAAGAAACTTGATGCTGG + Intergenic
935611574 2:105031301-105031323 CTGGAGAATAAACCTGAGAGGGG + Intergenic
940036108 2:149313590-149313612 CTGGATTGTAAACCTGATTCTGG - Intergenic
940749026 2:157603011-157603033 CTCTAAAATAATCCTGATGGTGG + Intronic
940841862 2:158592999-158593021 CTTGTAAATAAAGCAGATGCTGG - Intronic
941250080 2:163150622-163150644 TTGGTAAATAATCCTGATGCTGG - Intergenic
941562385 2:167063319-167063341 CTGCAAAATAAACCATATTCTGG - Intronic
942204749 2:173608922-173608944 CTGGAGAATAATCCTTAGGCAGG - Intergenic
942545332 2:177057460-177057482 CTGGAGAAAAATCCTGATGGTGG + Intergenic
945290853 2:208125960-208125982 ATGGAAAATAAACTTGTGGCTGG + Intergenic
946848735 2:223884674-223884696 CTGGAACATAAAGCAGATGTGGG - Exonic
948184339 2:236008145-236008167 CTAGAAAATAAAACTGATCACGG + Intronic
948549592 2:238761327-238761349 CTGGAGATTAAACCTGAAGAAGG + Intergenic
1169075987 20:2760047-2760069 CAGAACAATAAACCAGATGCAGG + Exonic
1169339476 20:4785437-4785459 CTGGAGAATAAAGCCGCTGCTGG - Intronic
1170581270 20:17701250-17701272 CTCCAAATTAAACCTGCTGCAGG - Intronic
1170592745 20:17783343-17783365 CAGGAAAATAAAACTCATCCAGG + Intergenic
1171267740 20:23786017-23786039 CTAGAAAAGAAATCTGTTGCTGG - Intergenic
1172781956 20:37441987-37442009 CTGGAAACAAAACCTGATAAAGG - Intergenic
1175046376 20:56109600-56109622 CTGGGAGATATACCTAATGCTGG + Intergenic
1175092958 20:56519922-56519944 ATGCAAAATAAAACTGATTCAGG - Intronic
1178303780 21:31473621-31473643 ATGGAAAATAAACCTTTAGCAGG + Intronic
1180014081 21:45071737-45071759 CTGGAAAATAAACCTGATGCTGG - Intergenic
1180763736 22:18229732-18229754 CTGGAATTTAAATCTGCTGCAGG + Intergenic
1180771908 22:18394811-18394833 CTGGAATTTAAATCTGCTGCAGG - Intergenic
1180803287 22:18644424-18644446 CTGGAATTTAAATCTGCTGCAGG - Intergenic
1181218430 22:21350837-21350859 CTGGAATTTAAATCTGCTGCAGG + Intergenic
1183451562 22:37898779-37898801 CTGGAAAATACACCTGGGACTGG - Intergenic
1203233745 22_KI270731v1_random:135801-135823 CTGGAATTTAAATCTGCTGCAGG - Intergenic
949803029 3:7924008-7924030 CTGGAATATAAACATGCTCCAGG - Intergenic
952289151 3:31998447-31998469 ATTGTAAATAAGCCTGATGCTGG - Intronic
953590138 3:44243236-44243258 CTGCCATATAAACCTGATGGTGG + Exonic
953789402 3:45935758-45935780 CTGGAATATAAGCTTGATGAGGG + Intronic
954466589 3:50658751-50658773 CTGGAAAACACAACTGGTGCTGG - Intergenic
956428854 3:69164501-69164523 CTTGAAGATATTCCTGATGCAGG - Intergenic
958664309 3:97114941-97114963 CTGGAAAATAAAGTTAATGAAGG + Intronic
958751524 3:98197276-98197298 CTGGAAAATACCCCTGTTCCTGG + Intronic
959546306 3:107600778-107600800 CTGGGAAGTAAACCTAATACAGG + Intronic
960600515 3:119453470-119453492 CTGGAAAATGAACCTTTAGCTGG - Intronic
960877130 3:122308294-122308316 CTGAAAAATAAACATGTGGCTGG - Intergenic
965795877 3:172438173-172438195 TTGGAATATAGGCCTGATGCTGG + Intergenic
969044180 4:4324555-4324577 TTGGAAAATAAACCTGAGAGGGG - Intergenic
969983168 4:11179761-11179783 CTGGACCATCAACCTGATGCTGG + Intergenic
970503919 4:16707574-16707596 CTGGCAAATAAAAATGAAGCCGG - Intronic
972476271 4:39452797-39452819 AGGGAAAAAAAACCTGTTGCAGG + Intergenic
975886356 4:78970290-78970312 CTGGAAAAAAAATCTGATTTGGG + Intergenic
978250373 4:106623754-106623776 CTGGGAGATATACCTAATGCTGG + Intergenic
978885956 4:113766674-113766696 CCTGAAAATAAGGCTGATGCTGG - Intergenic
981144296 4:141307219-141307241 CTGGAAAATAACACTGATGAGGG - Intergenic
982228481 4:153187054-153187076 CAGGAAGATAACCCTGATGAAGG + Intronic
984421755 4:179532199-179532221 CTGGAAACTAGACCTGCTGGAGG + Intergenic
984489902 4:180420094-180420116 CTGGAAATTTAACCTGAGGATGG - Intergenic
984553489 4:181186876-181186898 TTGGAAAATAAACTTTATACAGG + Intergenic
985917742 5:2937466-2937488 CTATAAAATAAACCTCAGGCGGG + Intergenic
986456290 5:7923891-7923913 CTCCAAAATAAAACTGATGAAGG - Intergenic
987648006 5:20701020-20701042 CTGGAAAACCAAACTGAAGCAGG + Intergenic
990785591 5:59415175-59415197 CTGGCAGATAAAGCTGATGAGGG + Intronic
991256171 5:64617609-64617631 CTGCAAAATAATCATGATGCAGG - Intergenic
991443043 5:66671334-66671356 CTGGAACACAAATGTGATGCTGG - Intronic
992174284 5:74134197-74134219 CTGGAAAATAAAAGTGATTGTGG - Intergenic
996483706 5:124005060-124005082 CTAGAAAATGACCCAGATGCTGG - Intergenic
997082883 5:130761633-130761655 CTGGATCATAAACTTGAGGCAGG + Intergenic
998029005 5:138847576-138847598 CTTGAAGAGAAACCTGATGGTGG + Intronic
998371511 5:141664926-141664948 CTGGGTAACAAAACTGATGCAGG + Exonic
1001919981 5:175592106-175592128 CTGGAATACAAACATGATGACGG + Intergenic
1003449468 6:6217557-6217579 CTGGGAGATATACCTAATGCTGG + Intronic
1004218587 6:13725123-13725145 CATGAAAATAAACATGATGAAGG - Intergenic
1004476537 6:15978652-15978674 CTGGAAATTAAAGCAGAGGCTGG - Intergenic
1004890536 6:20096601-20096623 CTGGAAAAGCCACCAGATGCTGG - Intergenic
1005008694 6:21314899-21314921 ATGGCAAATGAACCTGATGTGGG - Intergenic
1005442453 6:25884878-25884900 CTGGAAAAGAAAAGTGATCCTGG - Intergenic
1007930051 6:45682540-45682562 CTGGAATAAAAATCTGATGCTGG + Intergenic
1007969722 6:46038423-46038445 CTGGGAAGTCAACCTAATGCAGG - Intronic
1008527844 6:52424858-52424880 CTGGAAATTAGAACTGATGAGGG - Intronic
1008830670 6:55756791-55756813 ATGGAAGATAAAGCTGATGAAGG - Intronic
1009483503 6:64191444-64191466 CTGGACGATATACCTAATGCTGG - Intronic
1009975949 6:70671119-70671141 CTGAAAACTAAACTTGAAGCTGG - Intronic
1012983233 6:105851648-105851670 CAAGGAAATAAACCTGATGATGG + Intergenic
1015596811 6:134874246-134874268 CTGGAAACTTATCCAGATGCAGG + Intergenic
1016361956 6:143276846-143276868 CTTGGAAAGAAAACTGATGCAGG - Intronic
1016808853 6:148239986-148240008 CTGGGAGATGAACCAGATGCAGG - Intergenic
1017650664 6:156578622-156578644 CTGGAAAAAAAGCCTGAAGAAGG - Intergenic
1019393762 7:805383-805405 CTGGAAAACAAACCCCAGGCGGG - Intergenic
1021047259 7:15938971-15938993 CTGGAAATTAGACCTGCTGGTGG - Intergenic
1021072598 7:16260267-16260289 CTGGAAAATAAATCTGTTCTAGG - Intronic
1021865739 7:24955234-24955256 CTGGTAAATTAACCTGCTACTGG - Intronic
1022415157 7:30171211-30171233 CTGGATCATAAACCTAATGAAGG + Intergenic
1022835657 7:34111489-34111511 ATGGAAAATAAATCTGATTTGGG + Intronic
1023278435 7:38545367-38545389 CTTGAAAATAAACCTTAAGGGGG - Intronic
1024606885 7:51028840-51028862 CAGGGAAATGATCCTGATGCCGG + Exonic
1027728821 7:81843418-81843440 ATGGAAAATATACCTTATGTGGG - Intergenic
1028530553 7:91833219-91833241 ATGGAAAACATTCCTGATGCAGG - Intronic
1033684352 7:143624782-143624804 CTGGAATACAAACCTCATGATGG - Intronic
1033687528 7:143704001-143704023 CTGGAATACAAACCTCATGATGG - Intronic
1033700259 7:143832841-143832863 CTGGAATACAAACCTCATGATGG + Intergenic
1035535148 8:385386-385408 ATGGAAAACACACCAGATGCTGG + Intergenic
1039037172 8:33372521-33372543 CTAGAAAATAAACCTCAAGAAGG + Exonic
1039553516 8:38460330-38460352 CCCGAAAATACACCTGATGCAGG + Intronic
1040846894 8:51852935-51852957 CTGGAGAAGAAACAGGATGCAGG + Intronic
1043793239 8:84500746-84500768 ATGGAAATTAAATGTGATGCTGG + Intronic
1044850651 8:96424231-96424253 AGGGAAAATAAACAAGATGCAGG + Intergenic
1045260606 8:100570206-100570228 CTGGCAAGTGAAACTGATGCTGG - Intergenic
1046038475 8:108873531-108873553 CTGGAAAACATTCCTGAAGCAGG + Intergenic
1048555564 8:135472540-135472562 TTGGAGAATAAAGCTAATGCAGG + Intronic
1048889301 8:138933579-138933601 CTGGAAAATAAAGCTAGTACTGG + Intergenic
1049163071 8:141110139-141110161 CAGGACAACAAAGCTGATGCGGG - Intergenic
1049321883 8:142001068-142001090 CTGATAAATAAACCAAATGCTGG - Intergenic
1050943808 9:11492826-11492848 CTGGAAAATAATGCTGAAGAAGG - Intergenic
1052799264 9:32952565-32952587 CTGTAAAGGAAACATGATGCTGG + Intergenic
1055369798 9:75585163-75585185 CAGGAAAATGAACCTAATTCAGG - Intergenic
1055652330 9:78418673-78418695 CTGGGGAATAAAACTGATGTAGG + Intergenic
1055813231 9:80176734-80176756 CTACAAAATATACCTGAGGCTGG + Intergenic
1057058752 9:91984306-91984328 CTGAAAAGTAAAAGTGATGCTGG + Intergenic
1057534258 9:95883562-95883584 CTTCAAAATAAACATGAGGCTGG + Intronic
1058818175 9:108704651-108704673 GTGGAAAAGAAAACTGAAGCTGG - Intergenic
1061006272 9:127930010-127930032 CTGTAAAATAGAGATGATGCTGG + Intronic
1189367736 X:40402159-40402181 ATGGAAAAAACACCTGAGGCCGG + Intergenic
1190127099 X:47715838-47715860 TTGGAAAATAAACCTGAGAGGGG - Intergenic
1192152557 X:68721188-68721210 GTGGAAGATAAACCTGGTGCAGG + Intronic
1195332311 X:103813215-103813237 ATAGACAATAAAACTGATGCTGG - Intergenic
1199401205 X:147400984-147401006 ATGGAAAAGAAACCTGATTTGGG - Intergenic
1201353255 Y:13069520-13069542 TTGGAGAATAAACCTGAGGGGGG - Intergenic
1201395348 Y:13541660-13541682 CTGGGAGATATACCTAATGCTGG - Intergenic
1201704286 Y:16918336-16918358 CTAGAAAAAAAAACAGATGCTGG - Intergenic