ID: 1180014564

View in Genome Browser
Species Human (GRCh38)
Location 21:45074068-45074090
Sequence CCCCGCGCTCCTCCCTGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 1, 2: 8, 3: 37, 4: 279}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180014564_1180014570 -8 Left 1180014564 21:45074068-45074090 CCGCTGCAGGGAGGAGCGCGGGG 0: 1
1: 1
2: 8
3: 37
4: 279
Right 1180014570 21:45074083-45074105 GCGCGGGGGCCCGGGAGCCTGGG 0: 1
1: 0
2: 2
3: 52
4: 448
1180014564_1180014569 -9 Left 1180014564 21:45074068-45074090 CCGCTGCAGGGAGGAGCGCGGGG 0: 1
1: 1
2: 8
3: 37
4: 279
Right 1180014569 21:45074082-45074104 AGCGCGGGGGCCCGGGAGCCTGG 0: 1
1: 0
2: 5
3: 54
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180014564 Original CRISPR CCCCGCGCTCCTCCCTGCAG CGG (reversed) Intronic
900404219 1:2485455-2485477 CCCTGCTCTCCTCCCTGAGGAGG - Intronic
901143555 1:7050901-7050923 TCCAGCGCTGCTCCCTGCAGTGG - Intronic
901426474 1:9184716-9184738 CCCCGCTCTCCTCCCTGCGTTGG - Intergenic
901439984 1:9272045-9272067 CCCCGCGCGCCTCCCATCTGAGG - Intergenic
903033509 1:20479895-20479917 CCCCTCCCTGCTCTCTGCAGAGG + Intergenic
903211978 1:21823706-21823728 CTCTGCGGCCCTCCCTGCAGTGG + Exonic
903364745 1:22799148-22799170 CCCCTCGCTCCTCCCTCCTGTGG + Intronic
903534180 1:24055849-24055871 GTCCCCGCTGCTCCCTGCAGAGG + Intergenic
903555040 1:24187177-24187199 CCCCGCGCCCTTACCTGGAGCGG + Exonic
904044129 1:27600177-27600199 CCCCGCCCCCCTCCCTGGGGGGG + Intronic
904131907 1:28281659-28281681 CCCCACTCTCCTGCCTCCAGTGG + Exonic
904256872 1:29259850-29259872 CCTCACTCTCTTCCCTGCAGCGG + Exonic
904343086 1:29850780-29850802 CCCACAGCTCCACCCTGCAGAGG + Intergenic
904343509 1:29853277-29853299 CCCACAGCTCCACCCTGCAGAGG + Intergenic
904593653 1:31629267-31629289 CAGGGCTCTCCTCCCTGCAGTGG - Intronic
904755324 1:32765707-32765729 CCCCGCGCTCTGCTCTGGAGAGG + Intronic
904769093 1:32870974-32870996 CCCCGCACCTCTCCCCGCAGCGG - Intronic
906258462 1:44368198-44368220 CCCAGGGCTCATCCCTGCAGTGG - Intergenic
912226622 1:107741425-107741447 CCCTGCACTGCTCCCTGCAGAGG - Intronic
912970292 1:114275169-114275191 CCCAGCGCTGGTTCCTGCAGAGG - Intergenic
913293490 1:117296791-117296813 CCACGCACTCACCCCTGCAGTGG - Intergenic
915678232 1:157551976-157551998 GCCCACTCTCCTCTCTGCAGAGG - Intronic
917738314 1:177939998-177940020 CCATGCGCTCCTTCCTTCAGGGG - Intronic
917806902 1:178622037-178622059 TCCCGCTCGCCTCCCTGCATGGG + Intergenic
918839268 1:189513385-189513407 ACAGGCGCTCCTCCCCGCAGTGG - Intergenic
919728486 1:200898600-200898622 CCTCCCCCTCCTCCCAGCAGAGG - Intronic
920965460 1:210697386-210697408 CCCCGTGCTGCCTCCTGCAGGGG + Intronic
922603043 1:226871154-226871176 CCCCGCGCGCCTCCTTCCCGGGG - Intronic
923683945 1:236141657-236141679 GCCCGCGCGCCTCCCGGCACCGG + Intergenic
924451272 1:244181330-244181352 GCCTGCGTTCCTCCCTGCGGAGG + Intergenic
924633381 1:245763060-245763082 CCCTGGGCTCCTCCGGGCAGAGG + Intronic
1063614431 10:7589868-7589890 TCCCCGGCTCCTCCCTGGAGGGG + Intronic
1065019958 10:21495730-21495752 CGCCGCACTTCTCCCTGTAGCGG - Exonic
1065727083 10:28677270-28677292 TCCCGCGCTCCCCCTTGCGGAGG - Intergenic
1067837550 10:49650998-49651020 CCCCCAGCTCCACCCTCCAGAGG + Intronic
1067851980 10:49760186-49760208 CACCTCCCTCCTCCCTGCAGTGG - Intronic
1069686991 10:70324732-70324754 CCCAGCTCTCCTCCCTGCACAGG - Intronic
1069870393 10:71529380-71529402 CAGCGCTCTCCTCCCTGCACCGG - Intronic
1069921410 10:71817974-71817996 CCCCCTGCCCCTCCCTGCAGTGG + Intronic
1069934527 10:71906098-71906120 CCCCTGGCTCCTCCCCGCACTGG - Intergenic
1070400695 10:76051057-76051079 CCCAGGGCTGCTCCATGCAGGGG - Intronic
1070649312 10:78223229-78223251 CACGGCTCACCTCCCTGCAGAGG + Intergenic
1072003535 10:91220694-91220716 CGGCGCGCTCCCGCCTGCAGGGG + Intronic
1073064670 10:100750930-100750952 CTCCTGGCTCCTGCCTGCAGGGG + Intronic
1074638233 10:115345463-115345485 CCTCTCCCACCTCCCTGCAGTGG - Intronic
1076417222 10:130300642-130300664 GCCCGCGGTCCTGTCTGCAGGGG + Intergenic
1076417466 10:130301543-130301565 GCCCGCGGTCCTGTCTGCAGGGG + Intergenic
1076700086 10:132267023-132267045 CCCCGCCCACCCCGCTGCAGTGG + Intronic
1076710502 10:132331450-132331472 CCCCTCACTCCTCCGTCCAGAGG + Intronic
1077164662 11:1129642-1129664 CCCTGCACCCCACCCTGCAGAGG - Intergenic
1077252845 11:1568191-1568213 ACCTGCCCTCCTCCCTGCACTGG - Intronic
1077356454 11:2121096-2121118 CACCGAGCTCCTCCCAGCTGGGG + Intergenic
1077551130 11:3200789-3200811 CCCAGAGCCCTTCCCTGCAGGGG - Intergenic
1079137028 11:17781209-17781231 AACAGCGCTGCTCCCTGCAGTGG + Intronic
1081995156 11:47359281-47359303 CCTTGTTCTCCTCCCTGCAGCGG + Intronic
1083625489 11:64069965-64069987 CCCTGCTCTGCCCCCTGCAGAGG - Intronic
1083651861 11:64208710-64208732 CACCTTGCTCCTCCCTGCTGAGG - Intronic
1084145287 11:67261878-67261900 CCCTTCGCTCCTTTCTGCAGAGG - Intergenic
1084218995 11:67666388-67666410 CACCACGCAACTCCCTGCAGGGG + Exonic
1084269483 11:68021396-68021418 GGCCCCGCTCCTCCCTGGAGAGG - Intronic
1084492365 11:69485840-69485862 TCCCGTGGTCCTGCCTGCAGGGG + Intergenic
1089696096 11:120217172-120217194 CCCCACGCTCTTACCTCCAGTGG + Intronic
1090803176 11:130187351-130187373 CCCCGGGTTCCTCCCTGCCAAGG - Intronic
1090805810 11:130201410-130201432 CCCATCTCTCCTCCCTGCAAAGG - Intronic
1091433071 12:453117-453139 CCCCCCGCTCGGCCCTGGAGAGG - Intergenic
1091781004 12:3214662-3214684 ACACGCCCTCCCCCCTGCAGGGG + Intronic
1092936542 12:13369109-13369131 CACAGCGCTCCTCCCTCCAGAGG - Intergenic
1095703875 12:45216983-45217005 CCCTGCGGTCCTCCCTGCCTGGG - Intronic
1096789808 12:54037620-54037642 CCCCCCTCTCCACCCTGCAAGGG + Intronic
1097282378 12:57852888-57852910 TCCCACGCTCCTCCCTGCTCCGG + Intergenic
1098921282 12:76304485-76304507 CCTGGCATTCCTCCCTGCAGTGG - Intergenic
1100963073 12:99984746-99984768 CGCCGCGCTCCTCCCCGCCGCGG - Intergenic
1102466058 12:113131425-113131447 CCCCCAGCTCTCCCCTGCAGGGG + Intronic
1105427091 13:20303082-20303104 CACCTGGCTCCACCCTGCAGTGG - Intergenic
1105559953 13:21480919-21480941 CCCTGCCCTCCTGGCTGCAGTGG + Intergenic
1108323102 13:49305577-49305599 GCCCACGGCCCTCCCTGCAGCGG + Intergenic
1112494757 13:99895998-99896020 CCCCGCGCTCCTCCTGCCCGCGG - Exonic
1112580736 13:100674705-100674727 CGGCGCGCTCGGCCCTGCAGGGG + Intronic
1113399102 13:109975059-109975081 CCCCACACGTCTCCCTGCAGTGG + Intergenic
1113947847 13:114054511-114054533 CCCACCCCTTCTCCCTGCAGCGG + Intronic
1117546019 14:56795223-56795245 GCCAGCGCTCCTCCCTGCCTCGG - Intergenic
1120521855 14:85533784-85533806 CGGCGCGCGCCTCCCCGCAGCGG - Intronic
1121602132 14:95213287-95213309 TGCCACGCTCCTCTCTGCAGTGG + Exonic
1122505028 14:102226823-102226845 CCCGCCGCTCCTCCATGGAGGGG + Intronic
1127384507 15:58456533-58456555 CCCCCAGCACCTCCCTCCAGGGG - Intronic
1128453312 15:67819674-67819696 ACCAGCGCTCCTCACGGCAGGGG - Intergenic
1128646326 15:69381219-69381241 CCCAGTTCTCCTCCCTGGAGTGG + Intronic
1129391637 15:75223822-75223844 CCCAGTGTTCCCCCCTGCAGTGG + Intergenic
1129472662 15:75764032-75764054 CCCGGTGTTCCCCCCTGCAGTGG - Intergenic
1129681233 15:77659623-77659645 CCCTGGGCTCCTGCCTACAGGGG + Intronic
1132052648 15:98620221-98620243 CTCCGTGCTCCTCCCAGCAAGGG + Intergenic
1132556316 16:574275-574297 CCTCGGGCTCCTGCCGGCAGTGG - Exonic
1132983642 16:2752392-2752414 CCCTGTGCTCCTCCCCGCAGCGG + Exonic
1133223783 16:4330532-4330554 CCCCACCGCCCTCCCTGCAGAGG - Intronic
1135342879 16:21664087-21664109 CTGCGACCTCCTCCCTGCAGCGG - Intergenic
1138551805 16:57752626-57752648 CCCAGCGCTCCTCCCGGCAGTGG + Intronic
1139515681 16:67451171-67451193 CCCAGCTTTCCTCCCGGCAGTGG + Intronic
1140935170 16:79663581-79663603 CCCCTTGCTCCTCCCTGCCCTGG + Intergenic
1141449781 16:84090844-84090866 CCCCGAGGTCATCCCTGCTGGGG + Intronic
1141946061 16:87310893-87310915 GGCCGCGCTGCTCTCTGCAGAGG - Intronic
1141999007 16:87653332-87653354 CCCCGCTCTGCTCTCTGCTGTGG + Intronic
1142080853 16:88148054-88148076 CCCCGCTCTGCAGCCTGCAGTGG + Intergenic
1142112539 16:88339944-88339966 CCACTCGCTCCCCTCTGCAGGGG - Intergenic
1142319179 16:89370164-89370186 CCCCACGCCCCTCCCTGCCCTGG + Intronic
1142699245 17:1649421-1649443 CCGCGCGCAGCTCCCTGCGGAGG + Exonic
1143866409 17:9926821-9926843 CCCATCCCTCCTCCCTGCACTGG - Intronic
1144710513 17:17398701-17398723 CACCGCCACCCTCCCTGCAGTGG + Intergenic
1145234586 17:21199763-21199785 CCCCCAGCTCCTCCCCGCTGCGG + Intronic
1146547153 17:33749333-33749355 CGCCGCTCTCCTCCCAGTAGAGG - Intronic
1146958106 17:36948948-36948970 TCCCGCGCGCCTCCCGGAAGTGG + Exonic
1147456748 17:40542608-40542630 CCCCTGCCTCCCCCCTGCAGAGG - Intergenic
1148448527 17:47757142-47757164 CCACACCCTCCTCCCTCCAGGGG + Intergenic
1148846989 17:50535126-50535148 CCCAGCTCTTCTCCCTGCTGGGG + Intronic
1149905915 17:60526205-60526227 CCCAGCGCTGATCTCTGCAGGGG + Exonic
1150108651 17:62479247-62479269 CTCCACGCTCCTCCCGGGAGGGG - Exonic
1150137574 17:62704094-62704116 CCCCGCGCTCCGTCCAGCCGCGG - Intronic
1150752246 17:67875643-67875665 CACAGGGCTCCTCCCTTCAGAGG - Intronic
1152035542 17:77869978-77870000 CTCTGTGGTCCTCCCTGCAGTGG + Intergenic
1152376100 17:79919789-79919811 CCCCAGGCTCCTCCCTGCCTCGG - Intergenic
1152567009 17:81104922-81104944 CCCCAACCACCTCCCTGCAGGGG + Intronic
1152579107 17:81158218-81158240 CCCCGCCCTGCTCTCTGCCGCGG - Intronic
1152685253 17:81690706-81690728 CCCCGAACTGCACCCTGCAGCGG - Exonic
1152931826 17:83113929-83113951 CCCCGCGACCCTCCTTGAAGGGG + Intergenic
1154011629 18:10579484-10579506 CCCCCCGGGCCTGCCTGCAGAGG - Intergenic
1154034220 18:10783597-10783619 CCATGCCCTCCTCCCTGCTGGGG + Intronic
1154199170 18:12287557-12287579 CCGGTCGCACCTCCCTGCAGGGG + Intergenic
1154199193 18:12287663-12287685 CCAGCCGCTCCTCCCAGCAGAGG + Intergenic
1154255787 18:12779809-12779831 CCCCGAGCTCCTACCTGCTTAGG - Intergenic
1155071967 18:22324821-22324843 CCCCTCGCTCCACCCTCCCGGGG - Intergenic
1157094939 18:44679440-44679462 CCCCGCGATCTTCCTCGCAGGGG - Intergenic
1157284953 18:46371334-46371356 CCCCGTGACCCTCCTTGCAGTGG - Intronic
1158976564 18:62715927-62715949 CCCCCCGCTCTGCCCGGCAGCGG - Exonic
1160007029 18:75075360-75075382 CTGGGAGCTCCTCCCTGCAGAGG + Intergenic
1160631250 18:80247529-80247551 CCCCGCGCTCCTCCCGCGCGCGG - Exonic
1160734756 19:657455-657477 CCCCGCTGTCCTGCCCGCAGCGG + Intronic
1160932227 19:1576286-1576308 CACAGCTCCCCTCCCTGCAGCGG + Intronic
1161042571 19:2117776-2117798 CCCCGGGCTCCTCTGTGCGGTGG - Intronic
1161266649 19:3367379-3367401 CCTCCCGCTCCTCCCGGCGGCGG - Intronic
1161364089 19:3868522-3868544 CCCAGGTCTCCTCCCTGCATTGG + Intronic
1161973618 19:7596846-7596868 CCCCCCGCTCCTCCCGGCTGCGG + Intronic
1162034722 19:7932749-7932771 CCCGGCTCTGCTCCCTGCAGGGG - Exonic
1162471135 19:10872324-10872346 CCCCACCCTCCTCCCTGCAGAGG - Intronic
1162894816 19:13758955-13758977 CCCAGCGCTCCTCCTTGCGCTGG - Exonic
1163100591 19:15093714-15093736 ACCCGGCCTCCTCACTGCAGTGG + Intergenic
1163458151 19:17420670-17420692 TCCCCCGCTCCTCCCTGCAAGGG - Intronic
1164888700 19:31804810-31804832 CCCCGGGTTCCCTCCTGCAGTGG + Intergenic
1165245847 19:34498011-34498033 CCCCGCACTCCTCCCTGGCCTGG + Intronic
1166130020 19:40740476-40740498 CCCAGCGCTTTTCCCTGCAGGGG - Exonic
1166219043 19:41353678-41353700 CCTCCCCCTCCTCCCCGCAGTGG + Exonic
1167105816 19:47429541-47429563 CCACCCGCTCCTCCCCGCCGGGG + Exonic
1167210383 19:48130543-48130565 CCCCGCGTTCCTGGCTGGAGAGG + Intronic
1167622653 19:50568036-50568058 CCCCCCGCGCCTCCCCGCAGCGG - Intronic
1168108802 19:54180686-54180708 CCCCGCTCTCCTCCCGGCTAGGG + Intronic
925065724 2:927732-927754 CCCCGGGGTCCTGCCTGCATTGG - Intergenic
925102500 2:1259947-1259969 CCCCGCCCACCTGACTGCAGAGG + Intronic
925329354 2:3046676-3046698 CCCCACGCTCCTCCAAGCAGGGG + Intergenic
925854869 2:8119554-8119576 CCCCACGCCTCTCCCAGCAGTGG + Intergenic
925931188 2:8709451-8709473 GTCCTCACTCCTCCCTGCAGTGG + Intergenic
926914403 2:17878687-17878709 CCCCGCTCTCCTCGCCGCCGCGG + Intronic
927000985 2:18793923-18793945 CCTGGCTCTCCTTCCTGCAGTGG - Intergenic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
933729901 2:85448605-85448627 CCCCGTTCTCCACCCTCCAGGGG + Intergenic
933791850 2:85889163-85889185 CCCCGGGTGCGTCCCTGCAGGGG - Intergenic
938178807 2:129161547-129161569 TCCGGCTCTCCTTCCTGCAGGGG - Intergenic
941686984 2:168456881-168456903 CCCTGCTCTCCTCCCGGCAAGGG + Intronic
946365818 2:219248399-219248421 CCCTGGGCTCCTCCCTCCACAGG + Exonic
948889004 2:240897775-240897797 CCCCAAGCTGCTCCCTCCAGTGG + Intergenic
1170003992 20:11646465-11646487 CCCTGGTGTCCTCCCTGCAGTGG - Intergenic
1172275532 20:33677014-33677036 CCCTGCCTTCCTCCCTGCTGGGG - Intronic
1172503386 20:35443147-35443169 CCCTGGGCTCCTCTCTGGAGAGG - Intronic
1172913629 20:38428219-38428241 CCCCAGGCAGCTCCCTGCAGGGG + Intergenic
1174624471 20:51902916-51902938 CTTGACGCTCCTCCCTGCAGAGG + Intergenic
1175162684 20:57020749-57020771 CCCCTCTCTCCTGCCTGCAGGGG - Intergenic
1175814567 20:61876826-61876848 CCCAGCCCTCCACCCGGCAGTGG - Intronic
1178366970 21:31996357-31996379 CCCAGCTCTACTGCCTGCAGAGG + Intronic
1178430872 21:32517760-32517782 CCCTGCTCTCCCACCTGCAGGGG - Intergenic
1178719190 21:34992939-34992961 CTCCGCTCCCCTCCCTGCTGAGG - Intronic
1179502986 21:41821511-41821533 CCCCCTCCTCCTCCCTGCTGAGG - Intronic
1179899304 21:44380743-44380765 GCCCGGGGACCTCCCTGCAGGGG + Intronic
1180014564 21:45074068-45074090 CCCCGCGCTCCTCCCTGCAGCGG - Intronic
1180712229 22:17847127-17847149 CCTCTTCCTCCTCCCTGCAGTGG + Intronic
1181681983 22:24501741-24501763 CCCCACTCTCCTGCCTTCAGAGG - Intronic
1182557875 22:31138797-31138819 CTCCCCTCCCCTCCCTGCAGGGG - Exonic
1183164638 22:36138694-36138716 TCCCTCTCTCCTCCCTGTAGAGG + Intergenic
1183170940 22:36187844-36187866 TCCCTCTCTCCTCCCTGTAGAGG + Intergenic
1183211747 22:36455415-36455437 CGACGGGCTCCACCCTGCAGGGG + Intergenic
1183704876 22:39470192-39470214 CCCAGCGCTCATCCCTGCAGAGG - Intronic
1184049419 22:41993200-41993222 ACCCGCTCTCCTCCCTTCATAGG - Intronic
1184137908 22:42560204-42560226 CCCCGCACTCCTCACTCAAGTGG - Exonic
1184663378 22:45975768-45975790 CCCCGCGCTCCTCGCACCTGCGG - Intronic
1184866010 22:47202260-47202282 CCCCGGGGTCCACCCTGCACTGG - Intergenic
950116375 3:10452704-10452726 CCCAGCGCTCACCCCTCCAGCGG - Intronic
950471341 3:13188377-13188399 TACCGTGATCCTCCCTGCAGTGG - Intergenic
950702004 3:14757351-14757373 CACTGTGCTCCTCCTTGCAGAGG + Exonic
952416841 3:33097209-33097231 CCCCGCGCCCCGCCCCGCTGTGG + Exonic
953485103 3:43287018-43287040 CCCCGCGCCCCGCCCCGGAGCGG + Intronic
954379350 3:50211314-50211336 CCCAGCCCTCCTCCCTGCCCTGG + Intronic
954437652 3:50504380-50504402 CCCCTGGCTCTTCCCTGCTGTGG + Intergenic
954438030 3:50506201-50506223 CCCCTGGCTCTTCCCTGCTGTGG + Intergenic
954580605 3:51700986-51701008 CCCTGCCCGCCTCCCTGCTGTGG + Intronic
956065300 3:65391235-65391257 CCCCGAGTTCCCACCTGCAGAGG - Exonic
956642165 3:71425476-71425498 CCCCACCCTCCACACTGCAGTGG - Intronic
956668491 3:71664027-71664049 CCTGCCGCTCCTCCCTGCAGGGG - Intergenic
959017385 3:101150661-101150683 ACCCTGTCTCCTCCCTGCAGAGG - Intergenic
961234831 3:125357276-125357298 CCTCCTCCTCCTCCCTGCAGAGG + Intronic
961336122 3:126180622-126180644 CCCCGCGCCCCTCCCCTCACGGG - Intronic
961592283 3:127990091-127990113 CCCTGGGCTCCTCTCTGCAGTGG - Intergenic
961745794 3:129062753-129062775 CCCTCCTCTCCTCCCTCCAGGGG - Intergenic
964321158 3:155498555-155498577 CCCTGGTCTCCTCCCTGCAAAGG - Intronic
964338010 3:155678226-155678248 CCCCAGGCTCCTCCCTGAAAAGG + Intronic
968069816 3:195777960-195777982 TCCCGCCCTCCTCCCTGCCTGGG + Intronic
968523205 4:1043809-1043831 ACTCGCACGCCTCCCTGCAGAGG - Intergenic
968618738 4:1594059-1594081 CGCGGCGCCCCTCCCTGCAGCGG - Intergenic
968652953 4:1767300-1767322 CCCCGCGCCCCTCCCGGCCTGGG + Intergenic
969282179 4:6178097-6178119 CCCGACCCTCCTCCCTGGAGGGG + Intronic
969342846 4:6553189-6553211 CCCCGTTCTTCTCCCTGCGGTGG - Intronic
969425628 4:7122244-7122266 TCCCTCCCTCCTTCCTGCAGCGG + Intergenic
972740359 4:41881725-41881747 CCGCGCGCTCCTCTCCGCAGGGG + Intergenic
973314849 4:48749156-48749178 ACCTGCTCTCCGCCCTGCAGTGG - Intronic
978140943 4:105316874-105316896 CCCATCTCTACTCCCTGCAGGGG - Intergenic
978503538 4:109433822-109433844 CTCCGCCCACCTCCCTGAAGCGG + Exonic
980694282 4:136336391-136336413 CCCCATGATCCTCCCTGCAATGG + Intergenic
983920171 4:173335341-173335363 CCCCACGCCGCACCCTGCAGCGG + Intergenic
984917046 4:184734173-184734195 CCCCGGGCTCCTCCCTGGCCTGG + Intergenic
985727325 5:1523299-1523321 CCCCGCGCTCGTCCCTGGTCCGG - Intronic
985891178 5:2716093-2716115 CCCTGCGCTTCTCCTTGCAGTGG + Intergenic
985926202 5:3020951-3020973 CCCAGCGCTCCTCCCTCCTGGGG + Intergenic
986989501 5:13535228-13535250 CACCCCTCTTCTCCCTGCAGGGG + Intergenic
990382052 5:55227876-55227898 CCCCGCACTCTTCTCGGCAGTGG + Intergenic
992406044 5:76458907-76458929 CCCAGCACACCTCCCTGCACAGG - Intronic
997521301 5:134525943-134525965 TCCCGCGCCGGTCCCTGCAGCGG + Intronic
998095334 5:139393098-139393120 CGCCGCCCTCCTCCCCGCAGGGG + Exonic
1001769745 5:174284727-174284749 CCCCGTGGTCCTCCTTGCACTGG - Intergenic
1002192938 5:177488246-177488268 CCGCTCTCGCCTCCCTGCAGGGG - Exonic
1002316965 5:178349758-178349780 CCCCAGGCTCCTCCTTGCAGGGG + Intronic
1002460448 5:179370696-179370718 CCTCGCGCTCCTTCCTGGCGTGG - Intergenic
1002524473 5:179807383-179807405 CCCTGCGCGCCTCCGTCCAGAGG - Intronic
1003395297 6:5747687-5747709 CCCTCCGATCCTCACTGCAGGGG - Intronic
1003645589 6:7910832-7910854 CCCCGCGCCCCGCCCCGGAGAGG + Intronic
1004167863 6:13272625-13272647 CCCCGCCCTCCTCCCTGCAGCGG - Intronic
1005838188 6:29723555-29723577 CCCCTCACTCCTCCCCACAGAGG - Intronic
1005851717 6:29827945-29827967 CCCCTCCCTCCTCCGCGCAGGGG - Intronic
1005864258 6:29926558-29926580 CCCCTACCTCCTCCCCGCAGAGG - Intergenic
1005866655 6:29942654-29942676 CCCCTTGCTTCTCCCCGCAGAGG - Intronic
1005895155 6:30171812-30171834 CTGCGCGCTCCTCCCTCTAGGGG + Exonic
1005905561 6:30259725-30259747 CCACTCGCTTCTCCCCGCAGAGG - Intergenic
1006043285 6:31271949-31271971 CCCCTCGCTCCTCTCCGCAGAGG + Intronic
1006052872 6:31357037-31357059 CCCCTCGCTCCTCCCGGCAGAGG + Intronic
1006066053 6:31463307-31463329 CCCCTCGCTCCTTCCCGCAGAGG - Intergenic
1006943676 6:37769833-37769855 CCCCTCACTCCCACCTGCAGTGG - Intergenic
1008844869 6:55950580-55950602 GCCTGAGCTCCCCCCTGCAGTGG + Intergenic
1012399402 6:98832056-98832078 CCCCGCCCTCCTCCCGGCATAGG - Intergenic
1013099699 6:106975642-106975664 CCCCGCGCTCCTGCCTGCGGCGG + Intergenic
1014230323 6:118895103-118895125 CCTCGCTCTCCTCCCCGAAGCGG - Intronic
1016443633 6:144110127-144110149 CCCCGCGCCCCTCACTTTAGAGG + Intergenic
1016713879 6:147203090-147203112 ACCCGCGCTCCTCCCCGGCGAGG + Intergenic
1017412788 6:154186887-154186909 GGCACCGCTCCTCCCTGCAGAGG + Intronic
1018197584 6:161368633-161368655 CCCCCCTCCCCTCACTGCAGTGG + Intronic
1018847299 6:167564625-167564647 CCCCTCAGTCCTCCCTGCAAGGG - Intergenic
1019295482 7:271926-271948 CTCCTCGCTCCCCCCTGCAGGGG - Intergenic
1019295499 7:271990-272012 CTCCCCACTCCTCCCTGCAGGGG - Intergenic
1019295516 7:272054-272076 CTCCCCGCTCCTCCCTGCAGGGG - Intergenic
1019295533 7:272121-272143 CTCCCTGCTCCTCCCTGCAGGGG - Intergenic
1019295552 7:272185-272207 CTCCCCGCTCCTCCCTGCAGGGG - Intergenic
1019300001 7:298083-298105 CCCCGAGCTTCACACTGCAGGGG - Intergenic
1020137510 7:5595033-5595055 CCCCACGCCCCTCCCTCCAGCGG - Intronic
1020259100 7:6520706-6520728 CGGCGCTCACCTCCCTGCAGTGG - Exonic
1022943242 7:35258545-35258567 CCCGGGCCTCCTCCCGGCAGTGG + Intergenic
1022973488 7:35537301-35537323 CCCCCCGCCCCGCCCTGCCGCGG - Intergenic
1023879264 7:44309197-44309219 GCTGGTGCTCCTCCCTGCAGGGG + Intronic
1024279306 7:47706283-47706305 CCCTGAGCTGTTCCCTGCAGTGG - Intronic
1024572462 7:50734471-50734493 CGCCGCACGCCTCCCTGCTGTGG + Intronic
1026132356 7:67630971-67630993 CCCCGCATCCCTCCCCGCAGGGG + Intergenic
1027248027 7:76380211-76380233 CCCCGCGCGGCTCCCCGCGGAGG + Intergenic
1027269063 7:76510466-76510488 CCCCCAGCTCCTCCCTGCTGTGG + Intronic
1028983227 7:96989796-96989818 CCCCAAGCTCCTACCTGAAGGGG + Intergenic
1032037671 7:128531763-128531785 CTCCACGCTCCTCCCGGGAGGGG - Intergenic
1034351856 7:150421208-150421230 CGCCGCTCTCCTCCCGGCACCGG - Intergenic
1035088367 7:156281341-156281363 CACAGCGTTCCTCCCTCCAGAGG - Intergenic
1035291780 7:157844009-157844031 CCGCCCCCTCCTCCGTGCAGGGG - Intronic
1035591189 8:815272-815294 CACAGTGCTCCTCCCTTCAGAGG - Intergenic
1036501661 8:9319712-9319734 CCCCGCCCCCTACCCTGCAGAGG - Intergenic
1037390511 8:18387236-18387258 CCCCGCGCTCCTCCCGCTGGCGG + Intergenic
1037910636 8:22741754-22741776 CCCCGCTCTCCTGCCTGCCGGGG - Intronic
1038176279 8:25184522-25184544 CCTCGCGCGCTTCCCTGGAGCGG - Intergenic
1038611445 8:29063228-29063250 CAGCGCGCTCCTCCCTGCCTCGG + Intronic
1039050059 8:33484789-33484811 CCCCAGCCTCCTCCCAGCAGAGG + Exonic
1039435546 8:37556980-37557002 CCCACAGCTTCTCCCTGCAGGGG + Intergenic
1039881662 8:41629115-41629137 CACCTTGCTCCTCCCTGCTGAGG + Intergenic
1041096158 8:54352067-54352089 CCCCGCACTTCTCCCTGGATGGG + Intergenic
1041245544 8:55885471-55885493 CCCCGCTTTCCTCCCTCCATTGG + Intronic
1043472740 8:80578468-80578490 TCCCGCGCTCCTCCCAGCTCTGG + Intergenic
1046351950 8:113026245-113026267 CCCCAAGCTCATCCCAGCAGGGG + Intronic
1048496320 8:134939045-134939067 CCCCGCCCACCTCCCTAAAGAGG - Intergenic
1048577789 8:135706525-135706547 CACTGTGCTCCTGCCTGCAGAGG - Intergenic
1049206744 8:141367118-141367140 TCCTGAGCTGCTCCCTGCAGGGG - Intronic
1049651418 8:143771561-143771583 CCCGGCGCTCCTCCCGGCGGCGG - Intergenic
1051339997 9:16102334-16102356 CCCCGCAATCCTCCCTGGAAAGG - Intergenic
1053308936 9:37003021-37003043 CCCCGTGTTCCTTTCTGCAGGGG - Intronic
1054906690 9:70419385-70419407 CCCCGCGCTCCCGGGTGCAGGGG - Intergenic
1057025898 9:91733581-91733603 CCCCGCACACCACCCTGGAGAGG + Intronic
1057913919 9:99041111-99041133 CCCCTCCTTACTCCCTGCAGTGG - Intronic
1060480922 9:124016317-124016339 TCCCGCGCCCCTCCCTGCTCAGG + Intronic
1060901835 9:127264820-127264842 GCCCCGGCTCCTCACTGCAGGGG - Exonic
1060951747 9:127608444-127608466 TCCCCCGCTCCTCTCCGCAGCGG + Intergenic
1061593351 9:131613168-131613190 CCCCGCTTTCCTCTGTGCAGTGG - Intronic
1061618348 9:131794563-131794585 CCGTCCCCTCCTCCCTGCAGAGG - Intergenic
1061625540 9:131838857-131838879 CCGCTCAGTCCTCCCTGCAGTGG - Intergenic
1061913471 9:133737366-133737388 CGCCTGGCTCCTGCCTGCAGAGG + Intronic
1062348788 9:136128649-136128671 CCCCGAGCTCCTCCCTGCGAGGG - Intergenic
1062362261 9:136193619-136193641 CCCCGCTCCCCTCCCCGCGGCGG + Intergenic
1062532885 9:137009446-137009468 CCTCGCACTCCTCCATGCTGTGG + Exonic
1062594975 9:137295461-137295483 CCCCGCACTCCGCCCTGCCCCGG - Intergenic
1185695746 X:2193135-2193157 CCCCGAGCTCCACCCATCAGGGG - Intergenic
1186466423 X:9786944-9786966 CCCCTCCCTCCTCCGGGCAGGGG + Intronic
1187061860 X:15794329-15794351 CCCCCCGCCCCTCCCCACAGTGG + Intronic
1188539741 X:31236412-31236434 CCCCGCAATCCTCCTTGCGGTGG + Intronic
1189310651 X:40015040-40015062 CCCCGCGCTCCTCGTCGCCGCGG + Intergenic
1190265910 X:48827066-48827088 CCTCGGGCTCCTCCCGGGAGCGG + Intergenic
1190266889 X:48831969-48831991 CCCCGCGCCCGTCCCCGCCGCGG - Exonic
1194895253 X:99432391-99432413 CCCTCCGCTGCTCACTGCAGTGG - Intergenic
1196734792 X:118974251-118974273 CCCCCCACTCCTCCCAGGAGAGG - Intergenic
1196793250 X:119482827-119482849 CCTCTCGCACCTGCCTGCAGAGG + Intergenic
1199605908 X:149579573-149579595 CCCTGGGCTCCTCCCAGGAGGGG - Intergenic
1199633213 X:149789795-149789817 CCCTGGGCTCCTCCCAGGAGGGG + Intergenic
1201895964 Y:18993091-18993113 CCCCGCGCTCCTGCCTGCGGCGG + Intergenic