ID: 1180014818

View in Genome Browser
Species Human (GRCh38)
Location 21:45074984-45075006
Sequence GAGCCGAGCGCCGGAGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180014818_1180014822 -3 Left 1180014818 21:45074984-45075006 CCGTCTGCTCCGGCGCTCGGCTC No data
Right 1180014822 21:45075004-45075026 CTCCCGGAGGAAGCTGCGCCCGG No data
1180014818_1180014830 22 Left 1180014818 21:45074984-45075006 CCGTCTGCTCCGGCGCTCGGCTC No data
Right 1180014830 21:45075029-45075051 GGCCCCGCGTCCCCTCCCGAGGG No data
1180014818_1180014823 -2 Left 1180014818 21:45074984-45075006 CCGTCTGCTCCGGCGCTCGGCTC No data
Right 1180014823 21:45075005-45075027 TCCCGGAGGAAGCTGCGCCCGGG No data
1180014818_1180014826 1 Left 1180014818 21:45074984-45075006 CCGTCTGCTCCGGCGCTCGGCTC No data
Right 1180014826 21:45075008-45075030 CGGAGGAAGCTGCGCCCGGGCGG No data
1180014818_1180014829 21 Left 1180014818 21:45074984-45075006 CCGTCTGCTCCGGCGCTCGGCTC No data
Right 1180014829 21:45075028-45075050 CGGCCCCGCGTCCCCTCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180014818 Original CRISPR GAGCCGAGCGCCGGAGCAGA CGG (reversed) Intronic