ID: 1180014821

View in Genome Browser
Species Human (GRCh38)
Location 21:45074993-45075015
Sequence TTCCTCCGGGAGCCGAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180014821_1180014826 -8 Left 1180014821 21:45074993-45075015 CCGGCGCTCGGCTCCCGGAGGAA No data
Right 1180014826 21:45075008-45075030 CGGAGGAAGCTGCGCCCGGGCGG No data
1180014821_1180014829 12 Left 1180014821 21:45074993-45075015 CCGGCGCTCGGCTCCCGGAGGAA No data
Right 1180014829 21:45075028-45075050 CGGCCCCGCGTCCCCTCCCGAGG No data
1180014821_1180014830 13 Left 1180014821 21:45074993-45075015 CCGGCGCTCGGCTCCCGGAGGAA No data
Right 1180014830 21:45075029-45075051 GGCCCCGCGTCCCCTCCCGAGGG No data
1180014821_1180014840 30 Left 1180014821 21:45074993-45075015 CCGGCGCTCGGCTCCCGGAGGAA No data
Right 1180014840 21:45075046-45075068 CGAGGGCGCCGAGTCCGCGTGGG No data
1180014821_1180014839 29 Left 1180014821 21:45074993-45075015 CCGGCGCTCGGCTCCCGGAGGAA No data
Right 1180014839 21:45075045-45075067 CCGAGGGCGCCGAGTCCGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180014821 Original CRISPR TTCCTCCGGGAGCCGAGCGC CGG (reversed) Intronic