ID: 1180014824

View in Genome Browser
Species Human (GRCh38)
Location 21:45075006-45075028
Sequence GCCCGGGCGCAGCTTCCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180014824_1180014840 17 Left 1180014824 21:45075006-45075028 CCCGGAGGAAGCTGCGCCCGGGC 0: 1
1: 0
2: 3
3: 11
4: 208
Right 1180014840 21:45075046-45075068 CGAGGGCGCCGAGTCCGCGTGGG No data
1180014824_1180014829 -1 Left 1180014824 21:45075006-45075028 CCCGGAGGAAGCTGCGCCCGGGC 0: 1
1: 0
2: 3
3: 11
4: 208
Right 1180014829 21:45075028-45075050 CGGCCCCGCGTCCCCTCCCGAGG No data
1180014824_1180014839 16 Left 1180014824 21:45075006-45075028 CCCGGAGGAAGCTGCGCCCGGGC 0: 1
1: 0
2: 3
3: 11
4: 208
Right 1180014839 21:45075045-45075067 CCGAGGGCGCCGAGTCCGCGTGG No data
1180014824_1180014830 0 Left 1180014824 21:45075006-45075028 CCCGGAGGAAGCTGCGCCCGGGC 0: 1
1: 0
2: 3
3: 11
4: 208
Right 1180014830 21:45075029-45075051 GGCCCCGCGTCCCCTCCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180014824 Original CRISPR GCCCGGGCGCAGCTTCCTCC GGG (reversed) Intronic