ID: 1180014825

View in Genome Browser
Species Human (GRCh38)
Location 21:45075007-45075029
Sequence CGCCCGGGCGCAGCTTCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180014825_1180014840 16 Left 1180014825 21:45075007-45075029 CCGGAGGAAGCTGCGCCCGGGCG No data
Right 1180014840 21:45075046-45075068 CGAGGGCGCCGAGTCCGCGTGGG No data
1180014825_1180014839 15 Left 1180014825 21:45075007-45075029 CCGGAGGAAGCTGCGCCCGGGCG No data
Right 1180014839 21:45075045-45075067 CCGAGGGCGCCGAGTCCGCGTGG No data
1180014825_1180014829 -2 Left 1180014825 21:45075007-45075029 CCGGAGGAAGCTGCGCCCGGGCG No data
Right 1180014829 21:45075028-45075050 CGGCCCCGCGTCCCCTCCCGAGG No data
1180014825_1180014830 -1 Left 1180014825 21:45075007-45075029 CCGGAGGAAGCTGCGCCCGGGCG No data
Right 1180014830 21:45075029-45075051 GGCCCCGCGTCCCCTCCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180014825 Original CRISPR CGCCCGGGCGCAGCTTCCTC CGG (reversed) Intronic