ID: 1180014826

View in Genome Browser
Species Human (GRCh38)
Location 21:45075008-45075030
Sequence CGGAGGAAGCTGCGCCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180014811_1180014826 18 Left 1180014811 21:45074967-45074989 CCACCCTCCTGGGTCGCCCGTCT No data
Right 1180014826 21:45075008-45075030 CGGAGGAAGCTGCGCCCGGGCGG No data
1180014813_1180014826 14 Left 1180014813 21:45074971-45074993 CCTCCTGGGTCGCCCGTCTGCTC No data
Right 1180014826 21:45075008-45075030 CGGAGGAAGCTGCGCCCGGGCGG No data
1180014809_1180014826 26 Left 1180014809 21:45074959-45074981 CCTCGCACCCACCCTCCTGGGTC No data
Right 1180014826 21:45075008-45075030 CGGAGGAAGCTGCGCCCGGGCGG No data
1180014821_1180014826 -8 Left 1180014821 21:45074993-45075015 CCGGCGCTCGGCTCCCGGAGGAA No data
Right 1180014826 21:45075008-45075030 CGGAGGAAGCTGCGCCCGGGCGG No data
1180014812_1180014826 15 Left 1180014812 21:45074970-45074992 CCCTCCTGGGTCGCCCGTCTGCT No data
Right 1180014826 21:45075008-45075030 CGGAGGAAGCTGCGCCCGGGCGG No data
1180014806_1180014826 29 Left 1180014806 21:45074956-45074978 CCGCCTCGCACCCACCCTCCTGG No data
Right 1180014826 21:45075008-45075030 CGGAGGAAGCTGCGCCCGGGCGG No data
1180014810_1180014826 19 Left 1180014810 21:45074966-45074988 CCCACCCTCCTGGGTCGCCCGTC No data
Right 1180014826 21:45075008-45075030 CGGAGGAAGCTGCGCCCGGGCGG No data
1180014814_1180014826 11 Left 1180014814 21:45074974-45074996 CCTGGGTCGCCCGTCTGCTCCGG No data
Right 1180014826 21:45075008-45075030 CGGAGGAAGCTGCGCCCGGGCGG No data
1180014817_1180014826 2 Left 1180014817 21:45074983-45075005 CCCGTCTGCTCCGGCGCTCGGCT No data
Right 1180014826 21:45075008-45075030 CGGAGGAAGCTGCGCCCGGGCGG No data
1180014818_1180014826 1 Left 1180014818 21:45074984-45075006 CCGTCTGCTCCGGCGCTCGGCTC No data
Right 1180014826 21:45075008-45075030 CGGAGGAAGCTGCGCCCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180014826 Original CRISPR CGGAGGAAGCTGCGCCCGGG CGG Intronic