ID: 1180014827

View in Genome Browser
Species Human (GRCh38)
Location 21:45075022-45075044
Sequence GAGGGGACGCGGGGCCGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180014827_1180014839 0 Left 1180014827 21:45075022-45075044 CCCGGGCGGCCCCGCGTCCCCTC No data
Right 1180014839 21:45075045-45075067 CCGAGGGCGCCGAGTCCGCGTGG No data
1180014827_1180014847 28 Left 1180014827 21:45075022-45075044 CCCGGGCGGCCCCGCGTCCCCTC No data
Right 1180014847 21:45075073-45075095 GCCGCGCTGCGCCGCGGGGAGGG No data
1180014827_1180014846 27 Left 1180014827 21:45075022-45075044 CCCGGGCGGCCCCGCGTCCCCTC No data
Right 1180014846 21:45075072-45075094 CGCCGCGCTGCGCCGCGGGGAGG No data
1180014827_1180014845 24 Left 1180014827 21:45075022-45075044 CCCGGGCGGCCCCGCGTCCCCTC No data
Right 1180014845 21:45075069-45075091 ATGCGCCGCGCTGCGCCGCGGGG No data
1180014827_1180014843 22 Left 1180014827 21:45075022-45075044 CCCGGGCGGCCCCGCGTCCCCTC No data
Right 1180014843 21:45075067-45075089 GGATGCGCCGCGCTGCGCCGCGG No data
1180014827_1180014844 23 Left 1180014827 21:45075022-45075044 CCCGGGCGGCCCCGCGTCCCCTC No data
Right 1180014844 21:45075068-45075090 GATGCGCCGCGCTGCGCCGCGGG No data
1180014827_1180014840 1 Left 1180014827 21:45075022-45075044 CCCGGGCGGCCCCGCGTCCCCTC No data
Right 1180014840 21:45075046-45075068 CGAGGGCGCCGAGTCCGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180014827 Original CRISPR GAGGGGACGCGGGGCCGCCC GGG (reversed) Intronic