ID: 1180014830 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:45075029-45075051 |
Sequence | GGCCCCGCGTCCCCTCCCGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1180014818_1180014830 | 22 | Left | 1180014818 | 21:45074984-45075006 | CCGTCTGCTCCGGCGCTCGGCTC | No data | ||
Right | 1180014830 | 21:45075029-45075051 | GGCCCCGCGTCCCCTCCCGAGGG | No data | ||||
1180014824_1180014830 | 0 | Left | 1180014824 | 21:45075006-45075028 | CCCGGAGGAAGCTGCGCCCGGGC | 0: 1 1: 0 2: 3 3: 11 4: 208 |
||
Right | 1180014830 | 21:45075029-45075051 | GGCCCCGCGTCCCCTCCCGAGGG | No data | ||||
1180014825_1180014830 | -1 | Left | 1180014825 | 21:45075007-45075029 | CCGGAGGAAGCTGCGCCCGGGCG | No data | ||
Right | 1180014830 | 21:45075029-45075051 | GGCCCCGCGTCCCCTCCCGAGGG | No data | ||||
1180014821_1180014830 | 13 | Left | 1180014821 | 21:45074993-45075015 | CCGGCGCTCGGCTCCCGGAGGAA | 0: 1 1: 0 2: 1 3: 12 4: 94 |
||
Right | 1180014830 | 21:45075029-45075051 | GGCCCCGCGTCCCCTCCCGAGGG | No data | ||||
1180014817_1180014830 | 23 | Left | 1180014817 | 21:45074983-45075005 | CCCGTCTGCTCCGGCGCTCGGCT | No data | ||
Right | 1180014830 | 21:45075029-45075051 | GGCCCCGCGTCCCCTCCCGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1180014830 | Original CRISPR | GGCCCCGCGTCCCCTCCCGA GGG | Intronic | ||