ID: 1180014830

View in Genome Browser
Species Human (GRCh38)
Location 21:45075029-45075051
Sequence GGCCCCGCGTCCCCTCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180014825_1180014830 -1 Left 1180014825 21:45075007-45075029 CCGGAGGAAGCTGCGCCCGGGCG No data
Right 1180014830 21:45075029-45075051 GGCCCCGCGTCCCCTCCCGAGGG No data
1180014821_1180014830 13 Left 1180014821 21:45074993-45075015 CCGGCGCTCGGCTCCCGGAGGAA No data
Right 1180014830 21:45075029-45075051 GGCCCCGCGTCCCCTCCCGAGGG No data
1180014818_1180014830 22 Left 1180014818 21:45074984-45075006 CCGTCTGCTCCGGCGCTCGGCTC No data
Right 1180014830 21:45075029-45075051 GGCCCCGCGTCCCCTCCCGAGGG No data
1180014824_1180014830 0 Left 1180014824 21:45075006-45075028 CCCGGAGGAAGCTGCGCCCGGGC No data
Right 1180014830 21:45075029-45075051 GGCCCCGCGTCCCCTCCCGAGGG No data
1180014817_1180014830 23 Left 1180014817 21:45074983-45075005 CCCGTCTGCTCCGGCGCTCGGCT No data
Right 1180014830 21:45075029-45075051 GGCCCCGCGTCCCCTCCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180014830 Original CRISPR GGCCCCGCGTCCCCTCCCGA GGG Intronic