ID: 1180014837

View in Genome Browser
Species Human (GRCh38)
Location 21:45075044-45075066
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180014837_1180014846 5 Left 1180014837 21:45075044-45075066 CCCGAGGGCGCCGAGTCCGCGTG No data
Right 1180014846 21:45075072-45075094 CGCCGCGCTGCGCCGCGGGGAGG No data
1180014837_1180014845 2 Left 1180014837 21:45075044-45075066 CCCGAGGGCGCCGAGTCCGCGTG No data
Right 1180014845 21:45075069-45075091 ATGCGCCGCGCTGCGCCGCGGGG No data
1180014837_1180014849 10 Left 1180014837 21:45075044-45075066 CCCGAGGGCGCCGAGTCCGCGTG No data
Right 1180014849 21:45075077-45075099 CGCTGCGCCGCGGGGAGGGCAGG No data
1180014837_1180014844 1 Left 1180014837 21:45075044-45075066 CCCGAGGGCGCCGAGTCCGCGTG No data
Right 1180014844 21:45075068-45075090 GATGCGCCGCGCTGCGCCGCGGG No data
1180014837_1180014853 25 Left 1180014837 21:45075044-45075066 CCCGAGGGCGCCGAGTCCGCGTG No data
Right 1180014853 21:45075092-45075114 AGGGCAGGTGCGCCGGGACGAGG No data
1180014837_1180014847 6 Left 1180014837 21:45075044-45075066 CCCGAGGGCGCCGAGTCCGCGTG No data
Right 1180014847 21:45075073-45075095 GCCGCGCTGCGCCGCGGGGAGGG No data
1180014837_1180014851 18 Left 1180014837 21:45075044-45075066 CCCGAGGGCGCCGAGTCCGCGTG No data
Right 1180014851 21:45075085-45075107 CGCGGGGAGGGCAGGTGCGCCGG No data
1180014837_1180014852 19 Left 1180014837 21:45075044-45075066 CCCGAGGGCGCCGAGTCCGCGTG No data
Right 1180014852 21:45075086-45075108 GCGGGGAGGGCAGGTGCGCCGGG No data
1180014837_1180014843 0 Left 1180014837 21:45075044-45075066 CCCGAGGGCGCCGAGTCCGCGTG No data
Right 1180014843 21:45075067-45075089 GGATGCGCCGCGCTGCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180014837 Original CRISPR CACGCGGACTCGGCGCCCTC GGG (reversed) Intronic