ID: 1180014840

View in Genome Browser
Species Human (GRCh38)
Location 21:45075046-45075068
Sequence CGAGGGCGCCGAGTCCGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180014825_1180014840 16 Left 1180014825 21:45075007-45075029 CCGGAGGAAGCTGCGCCCGGGCG No data
Right 1180014840 21:45075046-45075068 CGAGGGCGCCGAGTCCGCGTGGG No data
1180014832_1180014840 -9 Left 1180014832 21:45075032-45075054 CCCGCGTCCCCTCCCGAGGGCGC No data
Right 1180014840 21:45075046-45075068 CGAGGGCGCCGAGTCCGCGTGGG No data
1180014827_1180014840 1 Left 1180014827 21:45075022-45075044 CCCGGGCGGCCCCGCGTCCCCTC No data
Right 1180014840 21:45075046-45075068 CGAGGGCGCCGAGTCCGCGTGGG No data
1180014833_1180014840 -10 Left 1180014833 21:45075033-45075055 CCGCGTCCCCTCCCGAGGGCGCC No data
Right 1180014840 21:45075046-45075068 CGAGGGCGCCGAGTCCGCGTGGG No data
1180014824_1180014840 17 Left 1180014824 21:45075006-45075028 CCCGGAGGAAGCTGCGCCCGGGC No data
Right 1180014840 21:45075046-45075068 CGAGGGCGCCGAGTCCGCGTGGG No data
1180014831_1180014840 -8 Left 1180014831 21:45075031-45075053 CCCCGCGTCCCCTCCCGAGGGCG No data
Right 1180014840 21:45075046-45075068 CGAGGGCGCCGAGTCCGCGTGGG No data
1180014828_1180014840 0 Left 1180014828 21:45075023-45075045 CCGGGCGGCCCCGCGTCCCCTCC No data
Right 1180014840 21:45075046-45075068 CGAGGGCGCCGAGTCCGCGTGGG No data
1180014821_1180014840 30 Left 1180014821 21:45074993-45075015 CCGGCGCTCGGCTCCCGGAGGAA No data
Right 1180014840 21:45075046-45075068 CGAGGGCGCCGAGTCCGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180014840 Original CRISPR CGAGGGCGCCGAGTCCGCGT GGG Intronic