ID: 1180014841

View in Genome Browser
Species Human (GRCh38)
Location 21:45075054-45075076
Sequence CGGCGCATCCCACGCGGACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180014841_1180014843 -10 Left 1180014841 21:45075054-45075076 CCGAGTCCGCGTGGGATGCGCCG No data
Right 1180014843 21:45075067-45075089 GGATGCGCCGCGCTGCGCCGCGG No data
1180014841_1180014857 28 Left 1180014841 21:45075054-45075076 CCGAGTCCGCGTGGGATGCGCCG No data
Right 1180014857 21:45075105-45075127 CGGGACGAGGCTGCGCCCTGGGG No data
1180014841_1180014851 8 Left 1180014841 21:45075054-45075076 CCGAGTCCGCGTGGGATGCGCCG No data
Right 1180014851 21:45075085-45075107 CGCGGGGAGGGCAGGTGCGCCGG No data
1180014841_1180014845 -8 Left 1180014841 21:45075054-45075076 CCGAGTCCGCGTGGGATGCGCCG No data
Right 1180014845 21:45075069-45075091 ATGCGCCGCGCTGCGCCGCGGGG No data
1180014841_1180014844 -9 Left 1180014841 21:45075054-45075076 CCGAGTCCGCGTGGGATGCGCCG No data
Right 1180014844 21:45075068-45075090 GATGCGCCGCGCTGCGCCGCGGG No data
1180014841_1180014847 -4 Left 1180014841 21:45075054-45075076 CCGAGTCCGCGTGGGATGCGCCG No data
Right 1180014847 21:45075073-45075095 GCCGCGCTGCGCCGCGGGGAGGG No data
1180014841_1180014854 26 Left 1180014841 21:45075054-45075076 CCGAGTCCGCGTGGGATGCGCCG No data
Right 1180014854 21:45075103-45075125 GCCGGGACGAGGCTGCGCCCTGG No data
1180014841_1180014846 -5 Left 1180014841 21:45075054-45075076 CCGAGTCCGCGTGGGATGCGCCG No data
Right 1180014846 21:45075072-45075094 CGCCGCGCTGCGCCGCGGGGAGG No data
1180014841_1180014849 0 Left 1180014841 21:45075054-45075076 CCGAGTCCGCGTGGGATGCGCCG No data
Right 1180014849 21:45075077-45075099 CGCTGCGCCGCGGGGAGGGCAGG No data
1180014841_1180014856 27 Left 1180014841 21:45075054-45075076 CCGAGTCCGCGTGGGATGCGCCG No data
Right 1180014856 21:45075104-45075126 CCGGGACGAGGCTGCGCCCTGGG No data
1180014841_1180014852 9 Left 1180014841 21:45075054-45075076 CCGAGTCCGCGTGGGATGCGCCG No data
Right 1180014852 21:45075086-45075108 GCGGGGAGGGCAGGTGCGCCGGG No data
1180014841_1180014853 15 Left 1180014841 21:45075054-45075076 CCGAGTCCGCGTGGGATGCGCCG No data
Right 1180014853 21:45075092-45075114 AGGGCAGGTGCGCCGGGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180014841 Original CRISPR CGGCGCATCCCACGCGGACT CGG (reversed) Intronic