ID: 1180014847

View in Genome Browser
Species Human (GRCh38)
Location 21:45075073-45075095
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180014836_1180014847 9 Left 1180014836 21:45075041-45075063 CCTCCCGAGGGCGCCGAGTCCGC No data
Right 1180014847 21:45075073-45075095 GCCGCGCTGCGCCGCGGGGAGGG No data
1180014831_1180014847 19 Left 1180014831 21:45075031-45075053 CCCCGCGTCCCCTCCCGAGGGCG No data
Right 1180014847 21:45075073-45075095 GCCGCGCTGCGCCGCGGGGAGGG No data
1180014832_1180014847 18 Left 1180014832 21:45075032-45075054 CCCGCGTCCCCTCCCGAGGGCGC No data
Right 1180014847 21:45075073-45075095 GCCGCGCTGCGCCGCGGGGAGGG No data
1180014838_1180014847 5 Left 1180014838 21:45075045-45075067 CCGAGGGCGCCGAGTCCGCGTGG No data
Right 1180014847 21:45075073-45075095 GCCGCGCTGCGCCGCGGGGAGGG No data
1180014837_1180014847 6 Left 1180014837 21:45075044-45075066 CCCGAGGGCGCCGAGTCCGCGTG No data
Right 1180014847 21:45075073-45075095 GCCGCGCTGCGCCGCGGGGAGGG No data
1180014834_1180014847 11 Left 1180014834 21:45075039-45075061 CCCCTCCCGAGGGCGCCGAGTCC No data
Right 1180014847 21:45075073-45075095 GCCGCGCTGCGCCGCGGGGAGGG No data
1180014842_1180014847 -10 Left 1180014842 21:45075060-45075082 CCGCGTGGGATGCGCCGCGCTGC No data
Right 1180014847 21:45075073-45075095 GCCGCGCTGCGCCGCGGGGAGGG No data
1180014828_1180014847 27 Left 1180014828 21:45075023-45075045 CCGGGCGGCCCCGCGTCCCCTCC No data
Right 1180014847 21:45075073-45075095 GCCGCGCTGCGCCGCGGGGAGGG No data
1180014841_1180014847 -4 Left 1180014841 21:45075054-45075076 CCGAGTCCGCGTGGGATGCGCCG No data
Right 1180014847 21:45075073-45075095 GCCGCGCTGCGCCGCGGGGAGGG No data
1180014835_1180014847 10 Left 1180014835 21:45075040-45075062 CCCTCCCGAGGGCGCCGAGTCCG No data
Right 1180014847 21:45075073-45075095 GCCGCGCTGCGCCGCGGGGAGGG No data
1180014827_1180014847 28 Left 1180014827 21:45075022-45075044 CCCGGGCGGCCCCGCGTCCCCTC No data
Right 1180014847 21:45075073-45075095 GCCGCGCTGCGCCGCGGGGAGGG No data
1180014833_1180014847 17 Left 1180014833 21:45075033-45075055 CCGCGTCCCCTCCCGAGGGCGCC No data
Right 1180014847 21:45075073-45075095 GCCGCGCTGCGCCGCGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type