ID: 1180014968

View in Genome Browser
Species Human (GRCh38)
Location 21:45075499-45075521
Sequence CGCCGCGGGCGGCCCGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 786
Summary {0: 1, 1: 0, 2: 11, 3: 97, 4: 677}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180014957_1180014968 22 Left 1180014957 21:45075454-45075476 CCTGCGTGTCCTTCCGAGGGCGC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG 0: 1
1: 0
2: 11
3: 97
4: 677
1180014959_1180014968 9 Left 1180014959 21:45075467-45075489 CCGAGGGCGCAGTGTCCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG 0: 1
1: 0
2: 11
3: 97
4: 677
1180014958_1180014968 13 Left 1180014958 21:45075463-45075485 CCTTCCGAGGGCGCAGTGTCCGC 0: 1
1: 0
2: 0
3: 8
4: 54
Right 1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG 0: 1
1: 0
2: 11
3: 97
4: 677
1180014962_1180014968 -6 Left 1180014962 21:45075482-45075504 CCGCGCGGGATGCTCTGCGCCGC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG 0: 1
1: 0
2: 11
3: 97
4: 677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180014968 Original CRISPR CGCCGCGGGCGGCCCGGGCC AGG Intronic
900123760 1:1060434-1060456 CGCCGAGGGGGGCCGGGGGCAGG + Intergenic
900157032 1:1207232-1207254 CCCCGCGGGCACCCAGGGCCCGG + Intergenic
900195768 1:1374836-1374858 AGTCGCGGGCGGGCCGGGACTGG + Exonic
900203143 1:1420192-1420214 GGCGGCCGGCGGCGCGGGCCTGG - Exonic
900349493 1:2227972-2227994 CGGAGCGGGCGGCGCGGGGCGGG + Intergenic
900376001 1:2355074-2355096 CGGCGCGGGGGGCCCGCGCGGGG + Intronic
900480326 1:2895047-2895069 AGCCGCGGGCGGCAGAGGCCTGG - Intergenic
901057383 1:6455033-6455055 GTCCGCTGGCGCCCCGGGCCGGG + Intronic
901433894 1:9234746-9234768 CGCCGCGCGCGCCCCCGGCCCGG + Intergenic
901500989 1:9652447-9652469 CAACGCGGGAGGCCCGGGACTGG - Intronic
901627285 1:10631454-10631476 GAGCGGGGGCGGCCCGGGCCTGG - Intergenic
901641324 1:10694540-10694562 TGCCGGGGCCGGCGCGGGCCGGG - Intronic
901673102 1:10867301-10867323 GGCCGCGGGCGGCGCGGGGACGG + Intergenic
901934564 1:12618570-12618592 GCCCGCGGGCGGCCCGGGCAAGG - Intergenic
902089613 1:13893002-13893024 CGGCGCGGGCCGCACGGGCGCGG - Intergenic
902169582 1:14599120-14599142 CGGCGGCGGCGGCCCCGGCCCGG + Exonic
902600939 1:17539842-17539864 CGCCGCGGGCGCCCATGGCCGGG - Exonic
903132737 1:21290247-21290269 CGCCGCGCCCCGCCCCGGCCTGG + Intronic
903190147 1:21651839-21651861 CGGCTCGCGCGGGCCGGGCCGGG - Intronic
903324736 1:22563445-22563467 CGCCGCCGCCGCCCCGGGCGGGG - Intergenic
903349877 1:22711088-22711110 CGCCGGCGGCCGCCCGTGCCCGG - Intronic
903925225 1:26826908-26826930 GGCGGCGGGCGGCGCGGGCCCGG - Exonic
903931642 1:26865467-26865489 CCCCGCGGCCGGCCCGGCCCAGG - Intergenic
904006629 1:27366473-27366495 CTCCGCGCGCAGCCCCGGCCCGG + Exonic
904500132 1:30908544-30908566 CCCCGTGGGCGGCCCCGGCACGG + Exonic
904642008 1:31938133-31938155 CGCCGCCGCCGGGCCGGGCCGGG - Exonic
905037875 1:34929482-34929504 TGGTGCCGGCGGCCCGGGCCGGG + Exonic
905124626 1:35708095-35708117 CGCCTCGAGTGGCGCGGGCCGGG - Intergenic
905179160 1:36156040-36156062 CGGCGCGGACGGCGCGGGCGCGG + Intronic
905183188 1:36178850-36178872 GGGCGCGGGCGCCGCGGGCCGGG + Intronic
905569251 1:38991142-38991164 AGCAGGGGGCGCCCCGGGCCGGG + Intergenic
905867103 1:41382360-41382382 CGAGGCGGGCGCCGCGGGCCTGG + Exonic
905867170 1:41382623-41382645 CGCCGCCGCCGGGCCTGGCCGGG + Exonic
906317983 1:44800399-44800421 CGCCACGCGCGGCCGGGGCCGGG + Exonic
906532825 1:46533221-46533243 GGCCGCGGCGGGCCCGGGCCAGG - Intergenic
906637010 1:47416484-47416506 CGCCGCCGCCGCCCCGGGCCGGG - Exonic
906650245 1:47508038-47508060 CGCCGCGGGCGTCCTTCGCCTGG + Intergenic
907051092 1:51330389-51330411 GGGCGCGGGCGGCGCGGGCTGGG - Intronic
908501207 1:64745199-64745221 CGGCGAGGGGGGCGCGGGCCTGG + Exonic
910237197 1:85048269-85048291 CGCCGCGGGAAGGCCGGGCCGGG - Intronic
910450103 1:87335395-87335417 GGCCTCGGGCGGCGCCGGCCCGG - Intronic
910934978 1:92480308-92480330 CGCCGCGCGCGGCCCTGCTCGGG - Intronic
911078862 1:93908998-93909020 CGCCGCGGGGCTCCCGGGGCAGG - Intronic
912381317 1:109249652-109249674 CGTCGGGGGCCGCCGGGGCCGGG + Intergenic
912492715 1:110070734-110070756 CGCCGCGGGGGGCGGGGGGCGGG + Intronic
914919511 1:151838077-151838099 GGCTGCGGGCGGCCAGGTCCGGG + Exonic
915253501 1:154608025-154608047 TGCCGCCGGCGGGTCGGGCCGGG - Exonic
915463191 1:156081738-156081760 CGCCGCGGGCGGCGGCGGCGGGG + Exonic
915544924 1:156591761-156591783 CGCCGGGGCCGGGCCGGGCCGGG + Exonic
917974281 1:180229480-180229502 CGCGGCGGGCGGCGCCGGCCCGG - Intergenic
918151097 1:181798751-181798773 AGGCGCGGGGGGCCTGGGCCAGG + Exonic
919463246 1:197902942-197902964 CGCCGCGGCCGCCCCGGGCTCGG + Intronic
919772379 1:201170891-201170913 CGCCCCAGGCGGCCTGGACCCGG - Intronic
920171235 1:204073574-204073596 CGCGGCGGGCGGGCCGGGTTGGG - Intronic
920385670 1:205568974-205568996 CGCCGCGGGCCTCCCCAGCCCGG + Exonic
920528340 1:206684909-206684931 CGCGGCCGCCGGCCCGGGGCTGG + Intergenic
922730600 1:227947166-227947188 CACCGCGGGACGCCCCGGCCGGG + Intronic
922739374 1:228006885-228006907 CGCCGCGGGGGGCGCCCGCCGGG - Intergenic
922739437 1:228007056-228007078 CGCCGGGGGGGGCCGGGCCCTGG - Exonic
922925382 1:229342946-229342968 CGCCACGCGCGCCTCGGGCCTGG - Intronic
922937189 1:229431942-229431964 CGCCGGGGGCCGGCGGGGCCTGG + Intronic
923056033 1:230426340-230426362 CGCCTCTGGCGGCTCGCGCCCGG - Intergenic
923171447 1:231421480-231421502 GGCCGCCGGCGGCCAGGGCTCGG - Exonic
923171644 1:231422224-231422246 CGTCCCGGGCGGCCCGGCCCAGG + Exonic
923372738 1:233328698-233328720 CGGCGCGCGCGGCGGGGGCCGGG - Exonic
923506440 1:234609743-234609765 CCCCCCGGCCGGCCCGGGCACGG + Intergenic
923782950 1:237042270-237042292 GGAGGAGGGCGGCCCGGGCCCGG - Exonic
924436785 1:244049190-244049212 AGCTGCGGGAGGCCCGGGCGCGG + Intronic
924446623 1:244138654-244138676 GACCGTGGGCTGCCCGGGCCTGG + Intergenic
924527229 1:244863570-244863592 CGCGGCGGGAGGCCCGCGCGGGG - Intronic
924560618 1:245154632-245154654 CCTGGCGCGCGGCCCGGGCCCGG - Intergenic
1062874108 10:931543-931565 CGGCGCGGCCGGGCCGGGCCGGG + Exonic
1063393680 10:5666593-5666615 GGCCCCGCGCGGCCCGGCCCAGG - Intronic
1063417914 10:5889249-5889271 GGCCGGGGGCTGCCCGGGGCCGG - Exonic
1063418232 10:5890287-5890309 AGCGGCCGGCGGCGCGGGCCCGG + Intronic
1063418274 10:5890420-5890442 CTGCGCGGGGGGTCCGGGCCCGG + Intronic
1063907792 10:10798656-10798678 AGCCGCGGGGCGCCAGGGCCCGG + Intergenic
1063929836 10:11018012-11018034 GGCCGCGGGCGGCGCGAGACGGG - Exonic
1064418011 10:15167925-15167947 CGCCGAGGGGGTCCCGGGCCCGG - Intronic
1064418088 10:15168201-15168223 CCCCGCCGGCGGCCTGGCCCAGG - Intronic
1066022883 10:31319972-31319994 CGCCGCGGGCGGACAGGGTTCGG + Intronic
1067066175 10:43105464-43105486 CGCGGCGCGCTGCCCGGGCGGGG + Intronic
1067300206 10:45001055-45001077 CAACGAGGGCGGCGCGGGCCCGG + Intronic
1069664690 10:70146500-70146522 CGCCTCGGGCTGTCCGGCCCGGG + Exonic
1070198104 10:74177195-74177217 CCCCGGGGGCGGCCCAGGGCCGG + Intronic
1070329488 10:75407521-75407543 CACCGCGGGCGAACCTGGCCAGG - Intergenic
1070570723 10:77637961-77637983 CGCCGCGGGCCGCCCGCGCCCGG + Intronic
1070752820 10:78973976-78973998 GGCGGCGGGCGGGCCGGGCCGGG - Intergenic
1070768139 10:79068145-79068167 CGCCCCGGGCGCTCCGCGCCGGG + Intergenic
1070800862 10:79243664-79243686 CGCCGCGGCCGCCGCCGGCCGGG + Intronic
1070923855 10:80205401-80205423 CTCCGCGGGCGTCCCGGGCGCGG + Exonic
1070954384 10:80454625-80454647 AGCCGCGGCGGGCCCGGGGCCGG + Intronic
1072679897 10:97498964-97498986 CGTCGCGGGCCCCCCTGGCCCGG + Exonic
1072710676 10:97713909-97713931 CGCCGCGGGCCGCACGCGCCTGG - Exonic
1072982975 10:100115222-100115244 TGCGGCGGGCGCCCCGGACCCGG + Intergenic
1073253130 10:102133813-102133835 CGGGGCTGGAGGCCCGGGCCGGG + Intronic
1074088386 10:110226003-110226025 TGCCGCGGGCAGCCCGCGCGTGG - Intronic
1074088420 10:110226130-110226152 CGCCGCAGGCGGCTACGGCCGGG - Intronic
1074169715 10:110919944-110919966 CGCCGCCGCAGGCCCGGCCCCGG - Intronic
1075048591 10:119165520-119165542 CGCCAAGTACGGCCCGGGCCCGG - Exonic
1075438511 10:122461820-122461842 AGCCGCACGCGTCCCGGGCCCGG - Exonic
1075645465 10:124093337-124093359 CGCCGGCGGCGGCCGGGGCTGGG - Intronic
1075693718 10:124418672-124418694 CTCTGCGGGCGGCTCGGACCCGG - Intronic
1075801783 10:125159213-125159235 CGCCCCGGGCGGCAGGGACCCGG - Intronic
1076722208 10:132397570-132397592 CGCCCCGGCCCGCCCCGGCCCGG - Intronic
1076850079 10:133088348-133088370 CGCCGCGGCCGGGCTGGGGCGGG + Intronic
1076900481 10:133335330-133335352 CGCCCCGGAGGGCCCGCGCCAGG + Intronic
1076986146 11:237090-237112 CACAGCGGGCTGCCCGGGCCCGG - Exonic
1076991992 11:280239-280261 CGCCGCGCGCGCCCCGGCTCAGG - Exonic
1077040418 11:518748-518770 CGTCGTGGGCAGCCCGGGGCCGG - Intergenic
1077341381 11:2027893-2027915 TGCAGGGGGCGGCCCGGGCCAGG - Intergenic
1077352019 11:2097500-2097522 CGCAGCGGGAAGCCCGGGGCTGG - Intergenic
1077360428 11:2138201-2138223 CGGCGTGTGCGGGCCGGGCCGGG - Intronic
1077374130 11:2197641-2197663 CACCTCGGGCGGCCCACGCCTGG - Intergenic
1077544980 11:3165267-3165289 CTCCACTGGCGGCGCGGGCCTGG + Exonic
1077900164 11:6481262-6481284 GTCCCCGCGCGGCCCGGGCCTGG - Exonic
1077914703 11:6603736-6603758 CGCCACGGGCGGGGCGGGGCCGG + Intronic
1078210343 11:9265189-9265211 CGCCGCCCCCGGCCCTGGCCCGG + Exonic
1078216319 11:9314725-9314747 TCCCGCGGGCGGGCCGGGGCGGG - Exonic
1078594453 11:12674578-12674600 GGACGCGGCCGCCCCGGGCCCGG - Exonic
1079296626 11:19240981-19241003 TGCGGCGGGCGGACAGGGCCTGG - Intronic
1079353521 11:19712909-19712931 CGCGGCTGGCGGGCCGGGCAGGG - Intronic
1080606668 11:33869763-33869785 CCCCGCGGGCGGCGCGGAGCCGG - Exonic
1080620921 11:33986389-33986411 CGGGGCGGCTGGCCCGGGCCGGG - Intergenic
1080802161 11:35618837-35618859 CGCCGCGGGCGTCCCACGCCAGG - Exonic
1081845609 11:46238391-46238413 GGCCGCGGGCTGCCGGGACCGGG - Intergenic
1081995414 11:47360537-47360559 CACCGCGCGCGGCCCTGGCTGGG - Intronic
1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG + Intronic
1083033487 11:59615484-59615506 GGCGGCGGGAGGCCCGGGCCCGG - Exonic
1083607151 11:63985963-63985985 CTCCGCGGGCGCCCCGGCGCTGG + Intronic
1083922240 11:65787207-65787229 CGCCGCGCGCCGTCCGGGCTCGG + Exonic
1083941595 11:65899341-65899363 GGCCTGGAGCGGCCCGGGCCCGG - Intronic
1084146266 11:67266845-67266867 CCCCGCGGGCGCCCCGGCCGCGG + Intronic
1084192749 11:67506232-67506254 CGCTGTGGGCAGCCTGGGCCTGG - Intronic
1084265612 11:68003869-68003891 CGGCGGGGGCGGGGCGGGCCGGG - Intronic
1084428635 11:69099427-69099449 AGGCGCGGCCGTCCCGGGCCTGG - Intergenic
1084575462 11:69985713-69985735 CGCAGCGGGAGGCCGGGGGCGGG + Intergenic
1084973025 11:72781679-72781701 CGCCGGGGCCCGCCGGGGCCGGG + Intronic
1087076215 11:94129094-94129116 CGCCGCCGGCGGGGCGGGGCGGG - Exonic
1087169588 11:95037565-95037587 CTCCGAGAGCAGCCCGGGCCTGG - Intergenic
1087172722 11:95067202-95067224 CTCCGAGAGCAGCCCGGGCCCGG - Exonic
1089533860 11:119149224-119149246 CGGTCCCGGCGGCCCGGGCCGGG - Exonic
1089713663 11:120336287-120336309 CGCCGGACGCGGCCAGGGCCGGG + Intergenic
1089738232 11:120564367-120564389 CGGCGCCGGTTGCCCGGGCCCGG - Intronic
1091310652 11:134573192-134573214 TGCCTCAGGCGGCCCAGGCCAGG + Intergenic
1202824366 11_KI270721v1_random:83082-83104 TGCAGGGGGCGGCCCGGGCCAGG - Intergenic
1094025794 12:25958817-25958839 CGCCGCGGGCGGGAAGGGCGAGG - Intergenic
1094466103 12:30754997-30755019 GGCCGAGGGCGGAGCGGGCCGGG - Intergenic
1094564921 12:31590796-31590818 CGCGGCGCCCGGCCCGGGCTCGG - Exonic
1095476277 12:42589910-42589932 CCCCGGGCGCGGCCCGAGCCGGG - Intronic
1095986733 12:48004346-48004368 CGCTGCGCTCCGCCCGGGCCCGG - Exonic
1096435897 12:51591078-51591100 GGCCGGGGCCGGCCCGGGCAGGG + Intronic
1096466124 12:51848511-51848533 GGCCGCGGGCGGGCCGGGATGGG - Intergenic
1097046297 12:56189642-56189664 CGCCAGGGTCGGCCCGCGCCTGG - Intergenic
1097107694 12:56635028-56635050 CGCCGCCGCCGGCCCAGGGCTGG - Intronic
1097929694 12:65170046-65170068 CGCCGCCGCCGGCCTGGTCCCGG - Exonic
1097990260 12:65825591-65825613 CGCGGCGGGCGGCCCGGGGAAGG + Intronic
1098105873 12:67068988-67069010 GGCACCGGGCGGCCCCGGCCCGG + Intergenic
1098105967 12:67069324-67069346 GGCGGCGGCCGGGCCGGGCCGGG + Intergenic
1099202012 12:79689692-79689714 GGCCGCAGCCGGACCGGGCCGGG - Intronic
1099365127 12:81758864-81758886 CACCCCGGGTGGCCCGGGCGCGG - Intronic
1100391538 12:94149254-94149276 CCCCCCGCGCGGCCCCGGCCCGG + Exonic
1100468814 12:94873099-94873121 CCCCGAGGGCGCCCCAGGCCAGG + Intergenic
1100468824 12:94873129-94873151 CGCCGTCGGCGGGCCGTGCCTGG + Intergenic
1100611403 12:96194362-96194384 CGGCGGGGGAGGCGCGGGCCTGG + Exonic
1102151018 12:110689175-110689197 GGGCGGGGGCGGCCCGGGCGGGG - Intronic
1102157483 12:110742739-110742761 CGCCGCCGCCGGCTCGCGCCCGG + Exonic
1102501815 12:113358519-113358541 GGCCGAGGGCGGGCGGGGCCGGG - Intronic
1102681333 12:114692515-114692537 CGCGGCGGGCTGCCCGGGTGGGG + Intergenic
1102997347 12:117360815-117360837 TCCCGCGGGCAGCCCGGGCTGGG - Intronic
1103510051 12:121467617-121467639 CGCGGCGCGCGGGCCAGGCCGGG - Intronic
1103527655 12:121578769-121578791 CGCAGAGGGCGGCCCGGGGTGGG + Intronic
1104568301 12:129903960-129903982 CGCCTCGGCCCGCCCGGCCCCGG + Intergenic
1104836833 12:131797273-131797295 GGCCGCGGGGGCCGCGGGCCGGG - Exonic
1104929212 12:132329391-132329413 CGCAGAGGGCTGCCCGGGGCTGG + Intergenic
1105413902 13:20193024-20193046 CGCCGCGGGCGGAGCGCGCCCGG + Intergenic
1105472066 13:20703731-20703753 CGCCGCCGCCGCCCCGAGCCGGG - Intronic
1106157384 13:27171446-27171468 CGGCCCGGGCGGCCCGGGCGGGG - Intronic
1106568508 13:30906688-30906710 CGCCGCCGGCTCCCCGGGCCTGG - Exonic
1107534173 13:41311652-41311674 GGCGGCGGCCGGCGCGGGCCAGG + Intronic
1108313888 13:49220106-49220128 GGCCGCGGCCCGCCCCGGCCCGG - Intergenic
1108541503 13:51451742-51451764 CGCCGCTGCCGGGCCGGGCCGGG + Intronic
1109789667 13:67230425-67230447 CGGCGCGGGCGGCCGCAGCCCGG + Intronic
1110705976 13:78602266-78602288 CGGCGCGGGCGGCGCGGGCGCGG - Exonic
1112216347 13:97434376-97434398 CGGGGCGGGCCGCCGGGGCCGGG + Exonic
1112290724 13:98142846-98142868 CGCCGCGCGGAGCCCGGCCCTGG + Intronic
1112402102 13:99086432-99086454 AGCGGCGGGCGGAGCGGGCCGGG - Intronic
1113311919 13:109140598-109140620 CGACGACGGCGGCCCGGGCGCGG + Exonic
1113312045 13:109141011-109141033 CGCGGGGGGCGGCCCGGGCGGGG - Exonic
1113378534 13:109784448-109784470 CGCCGCCGCCGTCTCGGGCCGGG + Exonic
1113492872 13:110706050-110706072 AGCAGCGGGGGGCCCAGGCCTGG + Exonic
1113492924 13:110706248-110706270 TGCCGCGGGCGACTCGAGCCAGG - Intronic
1113517693 13:110915486-110915508 CGCCTGGGGCGGCCGGGGGCGGG + Intergenic
1113784843 13:112997024-112997046 AGGCGAGGGCGGCCCGGGGCTGG - Intronic
1113808644 13:113124136-113124158 GGCCTCGGGAGCCCCGGGCCGGG - Intronic
1113874370 13:113585087-113585109 CGGGGCGGGGGTCCCGGGCCCGG + Intronic
1113896253 13:113766267-113766289 CCGGGCGGGCGGCCTGGGCCGGG + Intronic
1114269221 14:21091016-21091038 CTCCGGGGGTGGCCCGGGGCCGG + Exonic
1114629051 14:24147635-24147657 GGCCGCGCGCTGCCCGCGCCGGG + Exonic
1114674238 14:24430206-24430228 CGCGGTGGGCGGGCCCGGCCCGG + Intronic
1115399134 14:32938794-32938816 TCCCGCGGGCAGCCCGGCCCAGG - Intronic
1115850067 14:37583984-37584006 CGCAGCGGGCCGGGCGGGCCAGG + Intergenic
1115855053 14:37622233-37622255 CGCGCGGGGCGGGCCGGGCCGGG - Intronic
1117156925 14:52950938-52950960 TGCCGCGCGAGTCCCGGGCCCGG - Exonic
1117974085 14:61280889-61280911 CGCCGCGGCTGGCCAGGGCCGGG - Exonic
1119003907 14:70907528-70907550 GGCCGCGGGTGGCGGGGGCCGGG + Exonic
1119469028 14:74882094-74882116 CGCGGCGCGCCGGCCGGGCCGGG + Intronic
1119742946 14:77026200-77026222 CGCGGCGGGCGGCAAGGCCCCGG + Exonic
1120190523 14:81436113-81436135 AGCCGCGGGCGTCCCGGGGTGGG - Intronic
1121121690 14:91379756-91379778 CCCCGCAGGAGGCCCGGGCACGG - Intronic
1122137865 14:99645140-99645162 CGCCGCGAGCGCCCCGGGAGGGG + Exonic
1122162197 14:99793053-99793075 CGCGGCGGGCGGCCCTTGCGGGG - Intronic
1122317933 14:100836576-100836598 CCCCGAGAGCGGCTCGGGCCAGG + Intergenic
1122399790 14:101459538-101459560 CGGGGCGGCCGTCCCGGGCCGGG - Intergenic
1122486641 14:102086700-102086722 CGCCGCGGGGGTCCCCCGCCCGG - Intronic
1122582206 14:102777785-102777807 CGCCGCGCCGGGCCCGCGCCGGG - Intronic
1122719788 14:103715750-103715772 AGCCGCGCGCGGACCGGGGCGGG + Exonic
1122779770 14:104138716-104138738 CGCCGCGGCCGACCATGGCCGGG - Exonic
1122974983 14:105167413-105167435 CACCGCGGCCTGCCCGGGACCGG + Intronic
1122993194 14:105248598-105248620 CCCCGCGGCCGGGCCTGGCCGGG + Exonic
1123001995 14:105300792-105300814 CGTTGCGGGCGGCGCGGCCCGGG - Exonic
1123004566 14:105315034-105315056 CGCGGCGGGCGGCGCGTACCTGG - Exonic
1123024838 14:105419741-105419763 GGCCGCGGGCGGCGCGGGGTCGG + Intronic
1123024930 14:105420017-105420039 CGCCGCCGCCGGCCCGGACATGG + Exonic
1124098448 15:26670518-26670540 AGCTGCGGTCGGCACGGGCCTGG - Intronic
1124392188 15:29269477-29269499 CGGCGGGGGCGGCCTGGGCCCGG + Exonic
1124427019 15:29570864-29570886 CGCCGGGAGCGGGCCGGGCCGGG + Intergenic
1124628685 15:31325652-31325674 CTCCGAGGACGGCCCAGGCCTGG + Intergenic
1125834446 15:42737144-42737166 CGCCGCGGGCGGCCAGGGAGGGG + Intergenic
1126668424 15:51094700-51094722 CGGCGCGGGCGGCGCGGGCTGGG + Intronic
1127165820 15:56243948-56243970 GGCCGCGGGCGCGACGGGCCGGG + Intergenic
1127913063 15:63434420-63434442 CACCGCAGGCGTCCCTGGCCTGG + Intergenic
1129116561 15:73368280-73368302 GGCCGGGGTCGGACCGGGCCGGG + Exonic
1129144246 15:73633092-73633114 CGCCGGGGGCGGGCCGGGCGGGG - Intronic
1129162242 15:73753221-73753243 GGCCGGGGGCGGCCGGGGCGCGG - Intergenic
1129540256 15:76342568-76342590 TGCTGCGGGCGGGGCGGGCCCGG + Intergenic
1129592756 15:76931892-76931914 CGCCGCGGCCGGCGCCGGCAAGG + Exonic
1130390062 15:83447431-83447453 AGCCGCGGGGGGACCGGCCCGGG + Exonic
1130411735 15:83653860-83653882 CGCTCCGAGCGGCCCGGGCCTGG + Intergenic
1130517022 15:84633541-84633563 CGTCCCGGGCGGCCCGGCCCAGG - Intergenic
1130517144 15:84634088-84634110 TGCAGCGGGCGGCGCGGGGCCGG - Intergenic
1132478535 16:154215-154237 CGCCGGGCGGGGCCCGGGCTAGG + Intronic
1132514681 16:360648-360670 CGCGGCTGGGGGCCTGGGCCGGG - Intergenic
1132555528 16:570269-570291 GGCGGTCGGCGGCCCGGGCCTGG + Intronic
1132570569 16:642253-642275 AGACGCGCGCGGCCCCGGCCCGG + Intronic
1132570639 16:642454-642476 CCCCGCTGGGGGCCCGGGCCCGG - Intronic
1132585959 16:705843-705865 CGCCGCGCGCGCCCCCCGCCCGG + Intronic
1132588217 16:715337-715359 CGGCGCGGGCAGCCGGGGCCAGG - Exonic
1132696445 16:1204267-1204289 CGCTGGGGGCTGCCTGGGCCTGG - Exonic
1132728998 16:1351551-1351573 CGGCGAGGGCGGCCCGGGCCCGG - Exonic
1132841321 16:1979699-1979721 CACCGCGGGCAGGGCGGGCCAGG - Exonic
1132851442 16:2026744-2026766 CGCCTCGGGCTGGCCGGGCGCGG + Intronic
1132865637 16:2091482-2091504 CGCTGAGGGCGGCCAGGGCGCGG + Exonic
1132869642 16:2110126-2110148 TGCCGCTGCCGGCCAGGGCCGGG + Exonic
1132884958 16:2178521-2178543 CGGCGCGGGAGGGCCCGGCCAGG + Exonic
1132934712 16:2474621-2474643 CGCCGCGGGGCGCCCGGACGCGG - Intergenic
1132994748 16:2817201-2817223 CCCAGGGGGCGCCCCGGGCCCGG + Intronic
1133024777 16:2983803-2983825 GGGCGCGCGCGGCCCGCGCCTGG - Intergenic
1133038397 16:3046888-3046910 CCCCGCCGGCGGCCCGGGCTGGG + Exonic
1133188354 16:4116049-4116071 CGCCGCGGGCAGGGCCGGCCCGG - Exonic
1133219996 16:4315846-4315868 GGCAGCTGGCGCCCCGGGCCTGG + Intronic
1133286669 16:4693912-4693934 CGGCGCGGGCGGGCCCGGGCGGG + Intronic
1133784403 16:8963524-8963546 GGCGGCCGGCGGGCCGGGCCGGG + Intronic
1133784468 16:8963683-8963705 CGCCGCGCCCGGCCCGAGGCGGG - Intronic
1134134172 16:11668634-11668656 CGCGGCGGCGGGGCCGGGCCGGG + Intronic
1134628135 16:15737448-15737470 AGCTGCAGGCGGCCCTGGCCAGG - Exonic
1134717775 16:16365473-16365495 TGCCGCTGCCGGCCAGGGCCGGG - Intergenic
1134956976 16:18386686-18386708 TGCCGCTGCCGGCCAGGGCCGGG + Intergenic
1135382819 16:22008411-22008433 AGCCGCTGGCGCGCCGGGCCGGG + Intronic
1136003591 16:27313928-27313950 AGCCCCGCGCGGCGCGGGCCAGG + Exonic
1136365271 16:29806629-29806651 GGCCGCGCGGGGCCCGGGCTCGG - Exonic
1136453949 16:30370091-30370113 CGCCCCGGGGTTCCCGGGCCGGG - Exonic
1137426436 16:48384960-48384982 CGCCCCTGGAGCCCCGGGCCCGG - Intronic
1137618010 16:49858225-49858247 CGCCGCGGCCCGGCCGGCCCCGG - Intergenic
1137683222 16:50368826-50368848 CGCCGCTTCCGGTCCGGGCCAGG + Intronic
1138178793 16:54929058-54929080 CGGCCCAGGCGGCCCGAGCCTGG - Intergenic
1138360751 16:56425442-56425464 CGCCGCCGCCGCGCCGGGCCGGG + Exonic
1139390724 16:66605149-66605171 CGCCGCGGATGGCCTGGGCTCGG - Intronic
1139402905 16:66696533-66696555 CGCGCGAGGCGGCCCGGGCCGGG - Exonic
1139410049 16:66751651-66751673 AGCGGGGGGCGGCCCGGCCCGGG - Exonic
1139826654 16:69762472-69762494 GGCCGGGGGCGGCGCGGCCCGGG + Intronic
1139890552 16:70251105-70251127 TGCGGCGGGCGGCCCGCACCAGG + Exonic
1140046190 16:71441861-71441883 CTCCGCGGGCGGCCCCAGCCTGG + Intergenic
1140664004 16:77212463-77212485 CGCCGAGGGAGGCACAGGCCGGG - Intronic
1142049948 16:87951640-87951662 CGCCGCCAACCGCCCGGGCCGGG + Intronic
1142188532 16:88706333-88706355 GGCGGCGGGCGGCGCGGGCCTGG - Exonic
1142230249 16:88896785-88896807 CGCCCCGGCCAGCCTGGGCCTGG + Intronic
1142276550 16:89121977-89121999 CACTGCGGGGGGCCCAGGCCAGG - Intronic
1142276591 16:89122114-89122136 CACTGCGGGTGGCCCAGGCCAGG - Intronic
1142276630 16:89122251-89122273 CACTGCGGGGGGCCCAGGCCAGG - Intronic
1142379042 16:89721487-89721509 CGAGGCGGGCGGGGCGGGCCAGG - Intronic
1142586868 17:979468-979490 CGCGGCGGCCGGGCCGGGGCCGG - Exonic
1142657045 17:1400990-1401012 CGCCGCGCCCGGCCAGGGCCCGG - Intergenic
1142810693 17:2394233-2394255 GGCCGAGGGCCGCCGGGGCCCGG + Intronic
1143030387 17:3964213-3964235 AGCCGAGGGCGGCCTGAGCCCGG - Exonic
1143183618 17:4998301-4998323 AGCCGGCGGCCGCCCGGGCCTGG - Intronic
1143480409 17:7224741-7224763 AGCCGCAGGGGGCCTGGGCCTGG + Intronic
1143485372 17:7251316-7251338 GGCCGCGGGGGCCCCGGGGCCGG - Exonic
1143513577 17:7408327-7408349 CGCCCCGGGCGGCCCCGGCCTGG + Exonic
1143519477 17:7437416-7437438 CGGCACGGAGGGCCCGGGCCGGG - Exonic
1144586671 17:16491704-16491726 CGCGGGGGGCGCGCCGGGCCAGG - Intronic
1144695890 17:17303619-17303641 GGCGGCGGGCGGGCTGGGCCTGG + Exonic
1144758561 17:17694614-17694636 CGCCGCGGGCGGGGAGGGGCGGG - Intronic
1145163092 17:20589078-20589100 CCCCGCTGGGGGCCGGGGCCGGG + Intergenic
1146142392 17:30379196-30379218 GGCCGCGGGCCTCCCCGGCCTGG + Exonic
1146492369 17:33292210-33292232 AGCCGCGCGCAGCCCGCGCCAGG + Exonic
1146723903 17:35142204-35142226 CGCCGCGGGGCGCTAGGGCCCGG - Intronic
1147168721 17:38606118-38606140 CGCAGCGCGCGGCCGGGGCCGGG + Intergenic
1147285687 17:39401408-39401430 CGGCGGGTGCGGCCCGGGCCGGG + Exonic
1147307408 17:39573641-39573663 CGCCGCCGCCGGGCCGCGCCGGG + Intergenic
1147989744 17:44325384-44325406 TGCCGCGCGCGGCCGGGGCGGGG - Intergenic
1148090263 17:45019100-45019122 CGGCGCGGGCGGCCCGGGCGGGG + Intergenic
1148562583 17:48614344-48614366 CGCCGCCAGCGGCCTGGGCGAGG - Exonic
1148698762 17:49576099-49576121 GGCCGCGGGCCGCCGGGGACTGG + Exonic
1148818331 17:50346336-50346358 GGCTGCGGGCGGCCCCAGCCGGG + Intronic
1148899493 17:50865821-50865843 CGCCCCGGGCCGCCCGTCCCCGG + Intronic
1148929955 17:51120294-51120316 CTCCGGGGGCGGCCGGGGCGGGG - Intronic
1149993961 17:61397308-61397330 CCTCGCGGGCCGCCCGGGGCTGG - Intergenic
1150108555 17:62479008-62479030 GGCCGCGGGGGGCGCGGGACCGG - Exonic
1150217148 17:63477103-63477125 CGCCTCGGGCCGCCGGGGGCCGG + Intergenic
1150311033 17:64129822-64129844 AGCCGTGGGAGGCTCGGGCCGGG - Intronic
1150489015 17:65561705-65561727 CGGCGGGGGCGGGCCGGGGCGGG - Intronic
1150643592 17:66965067-66965089 CGCCGCGGGCGCGGCGGGGCGGG - Exonic
1150802273 17:68291585-68291607 TGGCGGGGGCGGCCCGGCCCCGG - Intronic
1150824825 17:68465218-68465240 CACCGCGCCCGGCCCCGGCCGGG + Intergenic
1151823874 17:76512786-76512808 GGCCGTGGGGAGCCCGGGCCAGG + Intergenic
1152225265 17:79089967-79089989 CACCGTGGGCGCCCAGGGCCAGG - Intronic
1152345535 17:79748481-79748503 CACCGCCGGCGGCCCAGGCGCGG - Intergenic
1152433321 17:80261067-80261089 CGCCGCGGGCGGGGCTGGACCGG - Intronic
1152571362 17:81122650-81122672 GGCGGCGTGGGGCCCGGGCCCGG - Exonic
1152617381 17:81344238-81344260 CGGCGCGGGCGTCCGGAGCCCGG - Intergenic
1152627760 17:81396137-81396159 CGCCGCGGACCGACCGGGCAGGG - Intronic
1152721939 17:81927604-81927626 CGGCGCGAGGGGTCCGGGCCCGG + Exonic
1152759109 17:82098953-82098975 GGCCGCGGGCGCCCCGGCCGGGG + Intergenic
1152861402 17:82698569-82698591 CGCCCTGGGCAGCCCGGTCCGGG - Exonic
1153480689 18:5543660-5543682 CGCGGCGGGCGGAGCGGGCGGGG + Intronic
1153805308 18:8705321-8705343 CGGCGCTGGCGGCGCGCGCCCGG - Intergenic
1154066351 18:11110697-11110719 CGGGGCGGGCGGGCCGGGGCGGG - Intronic
1155928808 18:31685094-31685116 GGCCGCGGGGCGCCGGGGCCCGG - Intronic
1156008595 18:32471017-32471039 GGGCGCTGGCGGCCCCGGCCGGG - Intergenic
1156099629 18:33578369-33578391 CGCGGCGGGCGGGCCGGGGGCGG - Intergenic
1157496656 18:48161692-48161714 CGCCCGGGCCGGGCCGGGCCGGG - Intronic
1157753002 18:50194946-50194968 CGCCGCGGCCGGCTCGCTCCCGG + Exonic
1158259044 18:55587920-55587942 CGCCGCGGGCTCCCGGCGCCCGG - Intronic
1158954063 18:62523292-62523314 CGCCGGGGGAGGGCCGGGGCCGG - Exonic
1159040650 18:63320309-63320331 CGCCGCGGCAGGCCCGGGAGTGG + Intergenic
1159798225 18:72868200-72868222 CGCGGCCGGCGCCCCGGGGCTGG + Intergenic
1160321508 18:77900304-77900326 CGCCTCCCGCGGGCCGGGCCGGG - Intergenic
1160404812 18:78638133-78638155 CGCCCCGGCCGGCCTGGGGCTGG + Intergenic
1160454762 18:78992729-78992751 CGCCCCGAGCGCACCGGGCCCGG + Exonic
1160517528 18:79486763-79486785 TGCTGCGGGCGGCCCGTGGCGGG - Exonic
1160568012 18:79798729-79798751 CGCCGAGCGCAGCCCGGGTCCGG + Intergenic
1160668387 19:344390-344412 CGCGCCGCGGGGCCCGGGCCGGG + Intronic
1160754670 19:751176-751198 GGCTGGGGGCGCCCCGGGCCGGG + Intronic
1160766851 19:812641-812663 CCACGCGGGCGGCCTGGGGCTGG - Exonic
1160792644 19:929639-929661 CGTCGGGGGCAGCCCGGGCCCGG - Exonic
1160864442 19:1250725-1250747 CTGCGAGGGCGTCCCGGGCCGGG + Intronic
1160947899 19:1652066-1652088 CGACGGGGGCGACGCGGGCCTGG + Intronic
1160982886 19:1824284-1824306 CGCCGTGTGCGGCCTGGGCCTGG - Intronic
1161014918 19:1978754-1978776 CGCGGCGGGCGGGGCGGGGCGGG + Intronic
1161175630 19:2841015-2841037 GCAAGCGGGCGGCCCGGGCCTGG - Intergenic
1161175806 19:2841662-2841684 CGCGGGGGGCGGCCCCGGCGAGG + Intronic
1161265096 19:3360140-3360162 CCCCGCGGGGTGCCCCGGCCCGG + Intronic
1161393989 19:4035103-4035125 CGCCTGGGGCGGCCCTGGCACGG + Intronic
1161400660 19:4065365-4065387 CGCAGCGCGCGGCCCCCGCCCGG + Intronic
1161495048 19:4581843-4581865 CGCCGCGGTTGCTCCGGGCCGGG - Intergenic
1161560270 19:4969202-4969224 CGGCGTGCGCGGCCCGGTCCGGG - Exonic
1161802631 19:6424545-6424567 CGGCGGCGGCGGCCCGGGCGGGG - Exonic
1161959555 19:7516208-7516230 CGGCGCGGGCGCGGCGGGCCGGG + Exonic
1162046737 19:8005324-8005346 CGCGGCGGGCGGGTCGGGGCGGG - Intronic
1162909841 19:13842824-13842846 AGCCTCGGCCGGCCCGGCCCGGG - Intergenic
1162929764 19:13952090-13952112 AGCCCCGGGCTGCCCGCGCCCGG - Intronic
1162954713 19:14091370-14091392 CGGCGGGGGCGGCCCTGGCAGGG - Intergenic
1163118128 19:15200346-15200368 CACCCCGGGCGGGCTGGGCCAGG - Intronic
1163138691 19:15332079-15332101 CGGCGCAGGCCGCCCCGGCCCGG + Intronic
1163282467 19:16325821-16325843 CGCCGCGGCAGCCCTGGGCCTGG + Exonic
1163320527 19:16572107-16572129 CGGCGCGGGGGGCACGCGCCAGG + Exonic
1163334398 19:16661372-16661394 GGCAGCGGGTGGCGCGGGCCGGG + Intronic
1163458015 19:17420164-17420186 CGCCGCTGGCTGGCCTGGCCTGG + Exonic
1163577175 19:18117823-18117845 GGCCGCGGGCGGCTGAGGCCGGG - Intronic
1163666680 19:18606854-18606876 CCCCGGGGCCGGGCCGGGCCGGG - Intronic
1163729532 19:18941151-18941173 CGGCGCGGAGGGCGCGGGCCCGG - Intronic
1163807062 19:19405862-19405884 CGCAGCGAGCGCCGCGGGCCCGG + Intronic
1163862234 19:19748484-19748506 GGCCGGGGGAGGCCCGGGCAGGG - Intergenic
1164989682 19:32674984-32675006 CGCGGCGGCCGGGCGGGGCCCGG - Intronic
1164992082 19:32691979-32692001 CGCCGCCAGCGGCTGGGGCCCGG - Exonic
1165058527 19:33194132-33194154 CGCGGCGGGGGGCGCGGGCGGGG + Intronic
1165058635 19:33194454-33194476 CGCCGCGGCCGGCCTGGGCCCGG - Intronic
1165065483 19:33225854-33225876 GGCCCCGGGCGGCGGGGGCCCGG + Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165419979 19:35717876-35717898 CGCCGCGGGAGACCGGGGGCCGG - Intergenic
1165493680 19:36140096-36140118 CGCTGCGGGAGGCCCGGGAGCGG + Exonic
1165745985 19:38229633-38229655 CGCCGCGCGCGGGCCCAGCCCGG + Intronic
1165938651 19:39404014-39404036 GGCCGCGGGCGGCTCTGGCACGG - Intergenic
1165943677 19:39428605-39428627 CGCCGCTGGGAGCCTGGGCCAGG - Intergenic
1166064353 19:40348399-40348421 CGGGGCGGGCAGCCCGGGCCGGG - Intronic
1166669885 19:44703540-44703562 CGCCCCGTGTGGGCCGGGCCAGG - Exonic
1166852846 19:45768686-45768708 CGGCGGCGGCGGCCGGGGCCGGG - Exonic
1167129178 19:47573150-47573172 CGCCCCGGGCGGCGCGGGGAAGG - Intergenic
1167133157 19:47600669-47600691 CGGCGCGGGCGGGCAGGGCCAGG + Intergenic
1167557062 19:50203349-50203371 CGCGGGGGGCGGCCGGGGGCGGG - Intronic
1168307317 19:55442650-55442672 CCCCGCGGGCGGGGCGGGCGCGG - Exonic
1168323812 19:55526560-55526582 CGCCGCGGGCGGGCGCCGCCTGG - Intergenic
1168339245 19:55614196-55614218 CGCCGCGGGGGGTCCTGGCGGGG - Exonic
1168584094 19:57578731-57578753 AGCGGCGGGCGACCCGGGGCGGG + Exonic
1168637958 19:58010759-58010781 AGCCGCCGGCCGCCCGGGGCTGG - Exonic
1168654695 19:58118473-58118495 GGCCGGGGCCGGCCCGGGGCGGG + Intergenic
1168719034 19:58544802-58544824 CGCCTCTGGCAGCCCGGGCCCGG + Exonic
926437637 2:12854170-12854192 CACCGCGGGGGGCTCGGGCATGG + Intergenic
926580829 2:14632278-14632300 CACTGCGAGCGGCCCGGGGCAGG - Intergenic
926581441 2:14634975-14634997 CGCCGCCGGTGGCCCGGGCCCGG + Exonic
927181143 2:20447449-20447471 CGCCATGAGCGGGCCGGGCCCGG - Exonic
927215852 2:20667443-20667465 CGCGGCGCGCGGCGCGGGCCCGG - Exonic
927667457 2:25042338-25042360 CGCCCCCGCGGGCCCGGGCCCGG - Intronic
927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG + Intronic
927713788 2:25340849-25340871 CGGCCCCCGCGGCCCGGGCCCGG + Intronic
927990342 2:27442769-27442791 CGCGGCAGGCGACCCGGGCGGGG + Intronic
929452901 2:42048410-42048432 TCCCGCGGGGGCCCCGGGCCCGG + Exonic
929604665 2:43226554-43226576 CTCCGCGGGGGGGGCGGGCCGGG - Exonic
932331536 2:70900811-70900833 AGCGACGGGCAGCCCGGGCCCGG + Exonic
932496696 2:72149080-72149102 GGCGGCGGGCGGCCGGGGCGGGG - Intergenic
932699901 2:73985209-73985231 AGGCGCGGGGGGCCCGGCCCGGG + Intergenic
933666946 2:84971515-84971537 CGCCGCGCCCGGCCCGGGCGGGG - Intronic
933772601 2:85753819-85753841 CGGCTCGGGCGGCCCGGGCTGGG + Intronic
935250137 2:101253426-101253448 CGCCGCGGGCGGGCGGCGCGGGG - Exonic
935265100 2:101387161-101387183 CGCGGGGGGCGGCCTGGCCCGGG + Exonic
936433262 2:112482223-112482245 CGGCGCGGGCGGCGGGGGCCGGG + Exonic
937132557 2:119524314-119524336 CGCAGCGGCCGGCCGGAGCCCGG - Exonic
938727271 2:134120076-134120098 CGCCGCGCGCGGCCCCGCCAGGG + Intronic
939900442 2:147844374-147844396 CGCAGCGCGCGTGCCGGGCCGGG - Intergenic
940140462 2:150486419-150486441 CTCCGCGGGCGGACTGCGCCTGG + Intronic
940640828 2:156342649-156342671 GGCCGCGGGCGGCCTGGGAAGGG - Intergenic
940954376 2:159712229-159712251 GGGCGCTGGAGGCCCGGGCCGGG - Intergenic
941021086 2:160408060-160408082 CTCCCCGGGCCGCCCGGCCCCGG - Intronic
941430744 2:165411006-165411028 CACCGCGCCCGGCCCGGGTCTGG - Intergenic
942098549 2:172556180-172556202 CGCCTTGGCCGGCCCGGGCCCGG + Exonic
942453508 2:176122877-176122899 CGCTTCGGGCCGCCGGGGCCAGG + Exonic
942799736 2:179861435-179861457 CGGCGGGGCCGGGCCGGGCCGGG - Exonic
943060469 2:183037854-183037876 CGCCGCCCGAGGCCCGGCCCGGG - Intronic
943060684 2:183038595-183038617 CGTAGTGGGCGGTCCGGGCCAGG - Exonic
944676016 2:202034511-202034533 CGCCGCCCACGGCCCGGCCCCGG + Intergenic
945225877 2:207530484-207530506 CGCCGCCGCCGGGCCGGGCGCGG + Intronic
945234989 2:207625358-207625380 GGGGGCGGGCGGCCCCGGCCCGG + Intronic
945431707 2:209772184-209772206 CACCGCGGGCCGCCCTGGGCTGG + Intronic
946235669 2:218323192-218323214 CCCCGCGGGGGGCCGGGGCCGGG + Intronic
946339190 2:219057404-219057426 CGCCGCCGGGGGGCTGGGCCCGG - Intronic
946404403 2:219484741-219484763 CGCCGCGGGCCTCCCAGGCCGGG - Exonic
946431780 2:219630165-219630187 CGAGTCGGGAGGCCCGGGCCCGG - Exonic
946747482 2:222860883-222860905 CGGCGCTGGCGGCCCGGGGCGGG - Intergenic
947353628 2:229271298-229271320 CGCCGCGCGCTCGCCGGGCCCGG - Intergenic
947418475 2:229921687-229921709 GGCCGCGGAAGGACCGGGCCGGG - Intronic
947435460 2:230068520-230068542 GGCCGCGCGCGCCGCGGGCCTGG - Intronic
947506608 2:230712860-230712882 CCCCGCTTGCGGCCCGAGCCCGG - Exonic
947860476 2:233354436-233354458 GGCCGAGGGCGGGCCGGGCCGGG - Intergenic
948046953 2:234952193-234952215 CGCCTCGGGCGGCAGGGCCCTGG + Intronic
948115772 2:235493827-235493849 CGCCCCCGGCGGGCCGGGCCAGG - Intergenic
948645356 2:239400820-239400842 CGCCGCCGGGGGCCCAGGCTGGG + Exonic
949004656 2:241638095-241638117 CGCCGCTCGCGTCCCCGGCCCGG - Intronic
1169048661 20:2558550-2558572 CGCCGGGGGCAGCCCAAGCCCGG + Exonic
1169214732 20:3786516-3786538 CGCCGCCGCCGCCCCGGGGCGGG + Exonic
1170578349 20:17681193-17681215 GGCCGCGGGCGGGGCGGGCCGGG + Intronic
1172118068 20:32583554-32583576 CGGCGCGGCCCGACCGGGCCGGG + Intronic
1172155363 20:32820182-32820204 CGGCGCGCGCGGGCTGGGCCTGG + Intronic
1172284742 20:33732409-33732431 CGGCGCGCGGGGCCCGGGACGGG + Intronic
1172474635 20:35227165-35227187 CGCCGAGGGCCGCCGAGGCCGGG + Intronic
1172568856 20:35953715-35953737 AGCTGCGGGCGGCCAGGGCCGGG - Exonic
1172890521 20:38260741-38260763 AGCCGCGGGCGGCGCGGGTCGGG + Exonic
1173166090 20:40688266-40688288 CGTCGCGTGCGGCCCGGGCCCGG + Exonic
1173813581 20:45971266-45971288 CGCCGCGGCCGCCCCGGGGCAGG - Exonic
1174054029 20:47785753-47785775 AGCCGCGGACGGCTGGGGCCCGG + Intronic
1174343866 20:49915391-49915413 CGCCGAGGACGGCCCGGCCGAGG + Intronic
1175399652 20:58693094-58693116 CTCCGCGGGCCGCCCGGGCCTGG - Intronic
1175466114 20:59192141-59192163 GGGGGAGGGCGGCCCGGGCCCGG + Exonic
1175485326 20:59342095-59342117 CGCTGCGGGAGGGCCGGGCTGGG - Intergenic
1175715420 20:61252127-61252149 CGGCGCGGGGGGCGCGGGCGCGG + Intergenic
1175911466 20:62407205-62407227 CGCGGCGGGTGGCGGGGGCCCGG + Exonic
1175926545 20:62474236-62474258 CGCCGGCGCCGGGCCGGGCCTGG - Intronic
1175975561 20:62708843-62708865 CGCCCCGCGCAGCCCGAGCCGGG + Exonic
1175992453 20:62796553-62796575 CGCCGCAGGCGACAAGGGCCCGG + Exonic
1176029796 20:63006470-63006492 CGGCGGCGGCGGCGCGGGCCAGG - Exonic
1176125380 20:63472594-63472616 CTCCGCGCGCGGCCCAAGCCCGG - Exonic
1176221140 20:63969830-63969852 GGCTGCGGCCGGGCCGGGCCGGG + Intronic
1176232274 20:64038563-64038585 CCCCGCGCCCGGCCCGGCCCGGG - Intronic
1176242127 20:64080027-64080049 CGCGGCGGGCGGGGCGGGCCCGG - Intergenic
1176380514 21:6110400-6110422 CGCCGCTGAGGGCCGGGGCCGGG + Intergenic
1176550273 21:8217868-8217890 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1176569201 21:8400906-8400928 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1176577115 21:8445138-8445160 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1178488008 21:33030973-33030995 CGCCGAGGGTGGCCCTGGACTGG + Intergenic
1178992770 21:37368099-37368121 CGGCGGGGCCGGGCCGGGCCGGG + Intronic
1179451814 21:41473299-41473321 TGCCAGGGGCGGCGCGGGCCGGG - Intronic
1179511877 21:41878966-41878988 CGCCGCGGGCGCTCCTGGCCGGG - Intronic
1179605662 21:42513874-42513896 CGCGGCGGCCGGGCCGGGCTGGG + Intronic
1179742958 21:43427840-43427862 CGCCGCTGAGGGCCGGGGCCGGG - Intergenic
1179783868 21:43719058-43719080 GGCCGGGGGCGGACCGGGGCGGG - Intergenic
1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG + Intronic
1180559103 22:16601547-16601569 CGTCGCGCGAGGCCCGCGCCGGG - Intergenic
1180559167 22:16601783-16601805 TGCTGCGGGCGGCCCGGGGGAGG + Intergenic
1180699696 22:17774523-17774545 CGCCGGGGGCGGGCCGGGGCGGG - Intronic
1180871698 22:19150280-19150302 CGCCCCGGCCGGGCCGGGCATGG - Exonic
1180874637 22:19169464-19169486 AGCGGGGGGCGGCCTGGGCCCGG - Intergenic
1181057711 22:20267890-20267912 GGCCGCTGGCGCCCCGGCCCCGG - Intronic
1181082928 22:20426065-20426087 AGGCCCGGCCGGCCCGGGCCCGG - Exonic
1181574874 22:23787300-23787322 CCCCGCGGGAGCCCCGGGGCGGG + Intronic
1181902783 22:26169674-26169696 CGCGGCGGGCGGCCGGGCCGCGG - Exonic
1182729432 22:32475136-32475158 CCCCGCGGGCCGCCCAGCCCCGG - Intronic
1183201418 22:36387763-36387785 CGCCGCCGCCTGCCCGGGGCGGG + Intronic
1183444472 22:37844070-37844092 CGGCGCGGGCCTCTCGGGCCGGG - Exonic
1183466743 22:37983910-37983932 CCCCGAGGGCGGCCCGAGACAGG + Intronic
1183546224 22:38455852-38455874 CGCCGCGGGCGGCGGGAGCTCGG - Intergenic
1183942137 22:41301903-41301925 CCCGGCGCGCGGCCCCGGCCTGG - Intronic
1184276338 22:43411593-43411615 GCCCGCGCGCGGCCCGGTCCGGG + Intronic
1184680700 22:46071081-46071103 CGGCGGGGGCGGGCCGGGCCGGG + Intronic
1185313760 22:50170295-50170317 CGCCGCCCGCGCTCCGGGCCGGG + Intergenic
1185313805 22:50170407-50170429 GGGGGCGGGCGGGCCGGGCCGGG - Intergenic
1185316167 22:50180132-50180154 CGCGGCGGGGGGCCCGGGTGGGG - Exonic
1185334953 22:50267313-50267335 GGGGGCGGGCGGGCCGGGCCCGG - Intronic
1185398425 22:50604070-50604092 GGACGCGGGCGGCGCGCGCCTGG + Exonic
1185409463 22:50674492-50674514 GGCCGGGGGGGGCCGGGGCCGGG - Intergenic
1185409518 22:50674605-50674627 CGGCGCGAGCGGCCCCGGCCCGG + Intergenic
1185413499 22:50697769-50697791 CGCCGCGCGCGGTGCTGGCCGGG + Intergenic
1185418095 22:50720854-50720876 CGCGTTCGGCGGCCCGGGCCCGG + Intergenic
1203255168 22_KI270733v1_random:134206-134228 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1203263224 22_KI270733v1_random:179285-179307 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
950040202 3:9915247-9915269 GGCCGCGCTGGGCCCGGGCCTGG - Exonic
950153737 3:10707684-10707706 GGCGGCGGGCGGGGCGGGCCGGG - Intronic
950406793 3:12810002-12810024 CTCCGCGGGCAACCTGGGCCAGG - Intronic
950509979 3:13420253-13420275 CGGCGCGGGCGGCCGGGCGCAGG - Exonic
950610599 3:14124552-14124574 CGCCTCAGGTGGCCCGCGCCCGG + Intronic
951611340 3:24495134-24495156 CGGAGCAGGCGCCCCGGGCCCGG - Intronic
952416728 3:33096819-33096841 CGTCGGGGGCGGGCCGGGCGGGG - Intronic
953027506 3:39153481-39153503 CGCAGGGGGCGTCCCCGGCCGGG - Exonic
953385292 3:42502698-42502720 CGCGGCGGGCGGCCCCGCGCGGG - Exonic
954110257 3:48429505-48429527 CCCCGCCCGCCGCCCGGGCCAGG + Intronic
954632824 3:52056370-52056392 GAGCGCGGGCGGCCCGGGGCCGG + Exonic
954838905 3:53494545-53494567 GGCCGTGGGCGGCTCGGGGCGGG + Intergenic
955325744 3:58008392-58008414 CGCCTCGCGCGGCCAGGGGCGGG + Exonic
956604949 3:71064859-71064881 CCGCGCGGGCGCCCCGAGCCCGG - Intronic
956674983 3:71725151-71725173 CGCCGCGCACGGCCCCGACCCGG - Intronic
961359422 3:126357562-126357584 CCGCGCGGGCGGGCCGGGGCGGG - Intergenic
963091404 3:141486937-141486959 CGCGGCGGGCGGGGCGGGGCGGG + Intergenic
964201238 3:154121455-154121477 CCCCGTGGGTGGCCCGGGTCCGG - Intronic
964757378 3:160100777-160100799 CGCCGCTTCCGGTCCGGGCCAGG - Intergenic
966743465 3:183254298-183254320 GGCCGTGCGCGGTCCGGGCCAGG - Intronic
966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG + Intronic
968323459 3:197791582-197791604 CGCCGGGAGCCGCCCCGGCCGGG + Intronic
968434107 4:576190-576212 CGGCGGCGGCGGCGCGGGCCCGG - Intergenic
968506449 4:973364-973386 GGCCGCGCGCGCCCGGGGCCGGG - Exonic
968514881 4:1011792-1011814 GGGCGCGGGCGGCTCGGGCCGGG - Intronic
968547755 4:1207323-1207345 CGCCGGGGCCAGCCGGGGCCAGG - Intronic
968571968 4:1346802-1346824 CGCCGGGGGCGGGGCCGGCCGGG - Intergenic
968582902 4:1403162-1403184 CGGCGGGGGCGGACCGGGACCGG - Exonic
968674957 4:1872002-1872024 CACCGCGGCCGCCCCGGACCGGG - Intronic
968701059 4:2058653-2058675 GGCCGCGGGGGGCGGGGGCCGGG + Intergenic
968701374 4:2059642-2059664 CGCGGCGGCCGGCCCGGGCGCGG - Exonic
968756486 4:2418701-2418723 CGCTGCGGGCGGGGCGGGCGGGG + Intergenic
968815303 4:2818605-2818627 CCCCGCGGGCGGACTGGGCACGG + Intronic
969122434 4:4920119-4920141 CGCCGCTGGTTGCCCAGGCCAGG + Intergenic
969239153 4:5888089-5888111 CGCCGCGGGTGGGGCGGGGCCGG - Intronic
969379396 4:6783624-6783646 GGCCGCAGGCGGGCGGGGCCGGG + Intronic
971351915 4:25862920-25862942 CGCGGCGGCCGGCCCGGCCGGGG - Exonic
972321574 4:37977415-37977437 GCCCGCGGGCGGCCGGGGGCGGG - Intronic
972437234 4:39045308-39045330 CGCAGCGGGGAGGCCGGGCCGGG - Intronic
973531868 4:51843428-51843450 CGCTGCGGGCGGCGTGGGGCGGG + Intronic
973613804 4:52659695-52659717 GGAAGCGGGCGGCCCAGGCCGGG + Intergenic
975612087 4:76213550-76213572 CGCCGCTCACGGGCCGGGCCGGG + Exonic
975710810 4:77158051-77158073 CGCCCCGGGCGGGCGGGGCTCGG + Intronic
975779014 4:77819761-77819783 CGGGGCGGGCGGGCCGGGCCGGG + Intergenic
975883578 4:78939294-78939316 CGCCGCTGGCGCCCCCGCCCCGG + Exonic
975986179 4:80202905-80202927 GGCCGCAGGCGGCGCGGGCGGGG + Exonic
979455640 4:120922844-120922866 GGGCGCGGGGGGCGCGGGCCTGG + Exonic
979547230 4:121951789-121951811 GGCCCCGGGCGGCCCAGGGCGGG + Intergenic
981128615 4:141133389-141133411 TGCCGCGGGCGGGGCGGGCTTGG + Intronic
981280626 4:142954533-142954555 CACCGCGGGGGGCTCGGGCATGG - Intergenic
981550279 4:145936613-145936635 GGGCGCGGGCTGCTCGGGCCAGG - Intronic
982291847 4:153789426-153789448 CCCCGCGTGCCGCCGGGGCCCGG + Intergenic
982435145 4:155376694-155376716 GGCCGCGGGCGTCCGGGGCCGGG - Intronic
983517188 4:168670443-168670465 CACCGCGCCCGGCCCGCGCCCGG - Intronic
984668034 4:182448965-182448987 CGCCGCGCGCAGCCCGAGCCCGG + Intronic
984928257 4:184825652-184825674 AGTCGCGGGCGGCGCGGGCGCGG - Intronic
984972491 4:185203719-185203741 CGCCGCGGGCGCCCCTGTCGTGG + Intronic
985064149 4:186104996-186105018 CGGCCGAGGCGGCCCGGGCCGGG - Intronic
985129097 4:186723881-186723903 CGGCGCCGGCGGGCGGGGCCGGG - Intronic
985512834 5:321848-321870 CACCGCGGGCGGCACGCGGCGGG - Intronic
985638530 5:1052296-1052318 CGGCGTGGGCAGCCTGGGCCTGG - Exonic
985638964 5:1054303-1054325 CGTCCCTGGCGGCCTGGGCCCGG + Intronic
985660712 5:1155519-1155541 CGCGGCGGGCGGCAGGGGCGGGG + Intergenic
989178731 5:38556248-38556270 CCCCAGGGGCGGCCCGGGCGGGG - Intronic
990545600 5:56817020-56817042 TTCAGCGGGCGGCCCGCGCCAGG - Intronic
991684297 5:69167426-69167448 CGCCGAGGTGGGCCCAGGCCTGG + Intronic
992641543 5:78772488-78772510 CGCCACAGGCAGCCAGGGCCGGG - Intergenic
993901712 5:93588493-93588515 GGCCCCGCGCCGCCCGGGCCTGG + Intronic
994072837 5:95620886-95620908 CGCCCCCGGCCGCCCGCGCCTGG + Exonic
994197272 5:96935223-96935245 CGGCGCCCGCGACCCGGGCCGGG + Intronic
994210743 5:97085319-97085341 CACCGCGGGGGGCTCGGGCATGG + Intergenic
997470482 5:134114641-134114663 CACTGGGGGCGGGCCGGGCCGGG - Intergenic
997584058 5:135034349-135034371 CGGCGCGGGCGGCTTGGGGCTGG - Intronic
997704108 5:135930628-135930650 CCCCTCCCGCGGCCCGGGCCCGG + Intronic
997984602 5:138492340-138492362 CGGCGCGGGAGGCGCGGGACGGG + Intergenic
998095768 5:139394828-139394850 AGCCGCCAGCGGCACGGGCCCGG - Exonic
998130370 5:139648667-139648689 CGCCGCGGCTGGCCCGAGGCGGG - Exonic
998341413 5:141421295-141421317 CGCTGCGGGGGTTCCGGGCCAGG + Exonic
998406677 5:141878264-141878286 AGCCGCCGCCGGCCCCGGCCTGG + Exonic
998861391 5:146447508-146447530 GGAGCCGGGCGGCCCGGGCCGGG + Intronic
1000014570 5:157266086-157266108 CGCCGCGCTCGGCCCCGCCCCGG - Exonic
1001065110 5:168529675-168529697 CGGCGGGGGCGGCCGGGGCCGGG + Exonic
1002424513 5:179167310-179167332 CGCCGGGTGCGTCCCCGGCCCGG - Intronic
1002487679 5:179550733-179550755 GGCCGCGGGCGGCCGAGGGCTGG + Exonic
1002512687 5:179733089-179733111 GGCCGCGGGCTGCACGGGCCGGG - Exonic
1002521842 5:179796581-179796603 CGCCCCGGGCTGCCCGGACTCGG - Intronic
1002524310 5:179806878-179806900 CTCCGCGGCAGGGCCGGGCCGGG + Intronic
1002638326 5:180618977-180618999 CGCCGCGGGCGGCGGGGGAATGG - Intronic
1002720933 5:181261219-181261241 TGCCGGGGGCCGCGCGGGCCGGG + Intergenic
1002887749 6:1311735-1311757 CCTCGCGGGCTGCCCGGGGCTGG + Intergenic
1003175969 6:3752187-3752209 CGGGGCGGGGGGCGCGGGCCGGG + Intergenic
1003212376 6:4079229-4079251 CGCCGCCGGCCGCCCAGGCGCGG + Exonic
1004842044 6:19598569-19598591 CACCGCGCCCGGCCCAGGCCGGG + Intergenic
1006337445 6:33428005-33428027 CGCGCCGGGCGGCGCGAGCCGGG + Intronic
1007236062 6:40392192-40392214 GGCCCCCTGCGGCCCGGGCCAGG - Exonic
1007371200 6:41427922-41427944 AGCCTCGGGGGCCCCGGGCCAGG + Intergenic
1007784083 6:44270521-44270543 GGCCGGGGGGGGCCGGGGCCGGG - Exonic
1008520986 6:52362258-52362280 CGCCGCGGGAGGCGCGGAACGGG + Intronic
1010209889 6:73354338-73354360 CCCCGCCCCCGGCCCGGGCCAGG + Intergenic
1010428138 6:75749062-75749084 CGCCGCGGGCGGGGCGACCCCGG + Intergenic
1010703323 6:79077828-79077850 GGCGGCGCGCGGCGCGGGCCGGG - Intronic
1011633853 6:89352648-89352670 CGGCTCGGGCGGACGGGGCCTGG + Exonic
1012401208 6:98843875-98843897 CCCCGCGGCCAGCCCGGGCGGGG + Intergenic
1013117705 6:107115194-107115216 CTCCCCGGGCCGCCCTGGCCAGG - Intronic
1013170795 6:107634947-107634969 CGCCGCCGGCGACCCAGGCCCGG + Exonic
1013272481 6:108557798-108557820 CATAGCCGGCGGCCCGGGCCGGG - Intergenic
1013369186 6:109455330-109455352 CGCTGCGGGTGGCCCGGACGAGG + Intronic
1013514770 6:110875498-110875520 GGCGGCGGGCGGCGCGGCCCGGG + Intronic
1013793689 6:113860434-113860456 CTCCGGGGGCGCGCCGGGCCCGG - Exonic
1014272268 6:119348781-119348803 CTCGGCGCGCGCCCCGGGCCCGG + Exonic
1014550959 6:122789402-122789424 CGCCACGGGCAGCCCGAGGCCGG - Exonic
1015366386 6:132401576-132401598 CCCTGCAGGCGGCCCGGGGCGGG - Intergenic
1016010655 6:139135150-139135172 CCGCGCGGGCGCCGCGGGCCCGG - Exonic
1016739106 6:147509231-147509253 CCCCGCGGGTGCCCTGGGCCGGG - Exonic
1017877655 6:158537236-158537258 CGCCGCGTGAGGCCCGAGCGGGG - Intronic
1018613041 6:165662130-165662152 CGCGGCGGGCGGCCTGGCCAAGG + Intronic
1018628730 6:165804790-165804812 CTCCGCCCGCGGCCCGGCCCCGG - Intronic
1018890509 6:167978254-167978276 CAGCGCGGGCGGCCGGGGCGAGG + Intergenic
1019279570 7:193042-193064 CCCTGCACGCGGCCCGGGCCCGG + Exonic
1019279606 7:193174-193196 CGCGCGGGCCGGCCCGGGCCTGG - Exonic
1019395817 7:816989-817011 CGCGGCGGGCGGCCCGGGCTGGG + Intronic
1019474373 7:1236832-1236854 CGGCGCGGGCGGCGGGGGCGCGG - Exonic
1019524095 7:1472974-1472996 CGCCTCGGACGGCCCAGGGCTGG + Intronic
1019578836 7:1750261-1750283 CTCCCCGGGGGGCCGGGGCCGGG - Intergenic
1020099953 7:5389064-5389086 CGCCGAGGGCCGCCAGGACCGGG - Exonic
1020204652 7:6105224-6105246 CGCCACCGCCCGCCCGGGCCAGG + Intronic
1020238614 7:6374943-6374965 CGGCCCGGGCGGCGCGTGCCTGG + Intronic
1020274312 7:6615536-6615558 CGCGGCGGGCGGGCAGGGGCGGG + Intergenic
1020274388 7:6615724-6615746 GCCTGCGGGCGGCCTGGGCCGGG - Exonic
1021313232 7:19117397-19117419 CCCCGCGCGCGGCGCCGGCCCGG + Exonic
1022094496 7:27130371-27130393 CGCCGGGGGCTGCTCGGGCTGGG + Exonic
1022094569 7:27130619-27130641 CGCAGACGGCGGCCCGGGCGGGG - Exonic
1022375379 7:29806904-29806926 CGCCCCGGCCGGGCCGGGCCGGG + Intronic
1022410455 7:30135440-30135462 CGCCGGGGAAGCCCCGGGCCGGG + Intronic
1022427887 7:30285323-30285345 CGCAGCGCGCGGGCCCGGCCCGG + Exonic
1023287071 7:38631257-38631279 AGCGGCGGGCGGCCGGGGCTGGG - Intronic
1023791863 7:43758892-43758914 CGCCCCGCCCCGCCCGGGCCCGG + Intronic
1023812938 7:43926482-43926504 CGCCTCAGGCAGCCCCGGCCGGG + Exonic
1023881860 7:44325324-44325346 CGGCGCGCGCGGGCTGGGCCGGG - Intronic
1026471052 7:70694404-70694426 CGCCGCGGGCTGCCTGGTCCTGG - Intronic
1026982759 7:74536289-74536311 GGCCGCGGGCCTCCGGGGCCAGG - Intronic
1028796400 7:94908106-94908128 CGCCGCGGGCGGGGAGGGTCGGG - Intronic
1029238739 7:99143830-99143852 CGGCGGGGCCGGGCCGGGCCGGG - Exonic
1029259793 7:99294069-99294091 CGAGGGAGGCGGCCCGGGCCTGG - Intergenic
1029372453 7:100158301-100158323 CACCGGGGGCGGCCCGGGCTTGG - Exonic
1029535272 7:101154331-101154353 CGCCGCGGGGAGCGCGGGCGGGG - Intergenic
1029640772 7:101817461-101817483 CGCCGCGGGGGGACCGTGCCGGG + Intronic
1029746411 7:102517781-102517803 CGCCGCAGGGGGGGCGGGCCGGG + Intronic
1029764348 7:102616760-102616782 CGCCGCAGGTGGGGCGGGCCGGG + Intronic
1030176602 7:106660830-106660852 CGCCCCGGGCGGCCGTGGCCGGG + Exonic
1030676769 7:112392778-112392800 CACCGCGCGCGGCCTGTGCCAGG - Intergenic
1032020709 7:128405970-128405992 TGCCGCGGGCCGGGCGGGCCGGG + Intronic
1032087255 7:128890798-128890820 CGACGTGGGCGGAGCGGGCCTGG + Intronic
1032119253 7:129144803-129144825 GGCCGGGAGCGGCGCGGGCCGGG - Intergenic
1032125321 7:129189007-129189029 CGTCCGGGGGGGCCCGGGCCCGG + Exonic
1033365997 7:140673036-140673058 GGTCGCGGGCGCCCGGGGCCTGG + Intronic
1033390729 7:140924846-140924868 CGCCGCGGGCGGAGGGCGCCTGG + Intergenic
1034227927 7:149497451-149497473 GGCCCCAGGCGGCCCGGCCCCGG - Intronic
1034243081 7:149624480-149624502 TTCCCCGGGCGACCCGGGCCCGG - Intergenic
1034494300 7:151410601-151410623 CGCCGCGGGCTCCCTCGGCCTGG + Intronic
1034618119 7:152436146-152436168 TGCCGCGGGCGGCTCGGGGGAGG - Intergenic
1034618216 7:152436460-152436482 CGTCGCGCGAGGCCCGCGCCGGG + Intergenic
1034902336 7:154915256-154915278 CGGCCCGGGCTTCCCGGGCCTGG + Intergenic
1034911564 7:155002660-155002682 GGGCGCGGGAGGCCCGGGCCCGG - Intronic
1035369236 7:158368557-158368579 CTGTGCGGGCGGGCCGGGCCAGG - Intronic
1035552904 8:544270-544292 CGGCGCGGGCGTCGTGGGCCCGG - Intronic
1036454190 8:8893381-8893403 CGCCTCGGGGGGCCCGGCTCCGG + Exonic
1036784823 8:11679392-11679414 CGCCGCGGGACGCCCCAGCCGGG + Intronic
1037529244 8:19757403-19757425 CGGCGGGGGCGGCCAAGGCCGGG + Intronic
1037807537 8:22066909-22066931 CGCCCTCGGCGGCCCCGGCCCGG - Intronic
1038017762 8:23529449-23529471 CGCCGCCAGCAGCCGGGGCCGGG - Intronic
1038176343 8:25184719-25184741 GACCGCGGGCGGCGCGGGCACGG + Intronic
1039527766 8:38231761-38231783 CGCCGCGCCCCGCCCGGGCTGGG + Exonic
1039542239 8:38381999-38382021 GGCCACGGCCGGGCCGGGCCGGG + Exonic
1039618356 8:38974665-38974687 CGCCGCGCGCCGCCTGGGCAAGG + Exonic
1039996787 8:42541389-42541411 CGGCGCGCGCAGCCCGGGCGGGG + Intronic
1039996885 8:42541763-42541785 CGGGGCGGGCGGCGCGGGGCGGG - Intronic
1041059438 8:54022035-54022057 CGCGGCGAGCGGCGCGGGCCGGG - Intronic
1041713035 8:60910338-60910360 CGCTGCGGCCGGGCCGGGCGGGG + Intergenic
1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG + Intronic
1042271559 8:66961610-66961632 CGCCGCCGGCCGCCCGCTCCCGG + Exonic
1042271583 8:66961662-66961684 CGTCCCGGGCGGACCGGGCCGGG - Exonic
1042611724 8:70607967-70607989 GGACGCGGGGGGCTCGGGCCCGG - Intronic
1043428444 8:80171496-80171518 CGCGGCGGGCGATCCGAGCCGGG - Intronic
1043769902 8:84184714-84184736 CGCTGCGGGCCGCGCCGGCCGGG + Intronic
1045098987 8:98825986-98826008 CGCGGCGGGTGGGCGGGGCCGGG + Intronic
1045111073 8:98940135-98940157 CTCGGCGTGCGGCGCGGGCCTGG + Intronic
1048554039 8:135457776-135457798 CGCCGCTGGGGGCGCGGGCGGGG + Exonic
1049082936 8:140457244-140457266 CGCCGCGGACGGCCCGGGAGGGG + Intronic
1049109707 8:140635397-140635419 CGGCGCGGGCGGCAGGGGCCGGG - Intronic
1049194526 8:141308127-141308149 CGGGGCGGCCGGGCCGGGCCGGG + Intronic
1049237263 8:141518568-141518590 CCGCGCGCGGGGCCCGGGCCCGG + Exonic
1049411362 8:142475370-142475392 CGCCGAGGCCGGCCCGGGTGGGG - Intronic
1049620912 8:143597956-143597978 GGGCGCGGGGGGCCCGGGCAGGG - Exonic
1049665506 8:143840989-143841011 CGCGGCGGACGGGCGGGGCCCGG + Intergenic
1049673180 8:143878580-143878602 AACCCCGCGCGGCCCGGGCCTGG + Intergenic
1049724223 8:144138063-144138085 CGCGGGCGGCGTCCCGGGCCGGG - Exonic
1049788494 8:144462544-144462566 CCCGGCGGCCGCCCCGGGCCCGG + Intronic
1049788525 8:144462612-144462634 CGGCGGGGGCGGCCCGGCCGCGG - Intronic
1049998379 9:1051717-1051739 CGCCGGCGGCGGGCTGGGCCCGG - Exonic
1051629256 9:19127364-19127386 CGCCGCTGGGGGCCCGGGACCGG + Intronic
1053122992 9:35560254-35560276 CGCTGCAGCTGGCCCGGGCCCGG + Exonic
1056224279 9:84480254-84480276 CGCGGCGTGGGGCCCGGGCAAGG - Intergenic
1056475175 9:86946299-86946321 CGGCGCGGGCGGCCCCGGCGCGG - Exonic
1057232903 9:93335621-93335643 CCCAGGGGGCGCCCCGGGCCAGG - Exonic
1057252609 9:93516000-93516022 CCCAGGGGGCGCCCCGGGCCAGG + Exonic
1057547207 9:96027435-96027457 CGCGCCGGGCTGCCCCGGCCAGG - Intergenic
1057881532 9:98796306-98796328 CGCCGCTGCGGCCCCGGGCCCGG + Exonic
1057883061 9:98807814-98807836 CGCAGCGTGGGGCCGGGGCCGGG + Exonic
1057921990 9:99105160-99105182 CGGCGCGGCCGGGCCGGGCCGGG + Exonic
1057933989 9:99221639-99221661 CGCCGCGGCCGCCCCAGCCCAGG + Exonic
1059208262 9:112486801-112486823 GGGCGCGGGCGGGCCGGGGCGGG - Intronic
1059375232 9:113876171-113876193 CGGCGCGGCCGGTGCGGGCCGGG + Intergenic
1060209014 9:121699201-121699223 GGCCGAGGGCGGGCCGGGCTCGG - Intronic
1060389863 9:123268442-123268464 CGCCGCGCTCTGCCCGCGCCCGG + Intronic
1060479969 9:124012172-124012194 CCCCGCGAGCGCCCGGGGCCCGG + Exonic
1060598364 9:124861724-124861746 AGAGGCGCGCGGCCCGGGCCTGG - Intronic
1060811573 9:126613759-126613781 CGCGGCGCGGGGCGCGGGCCAGG + Intergenic
1061084985 9:128393323-128393345 CGCCTCTGGCGGCTCGGGGCCGG + Intergenic
1061158942 9:128882327-128882349 TGCCCCGGGCGCCCCGGGCCGGG - Intronic
1061262642 9:129488563-129488585 CCTGGCGGGCGGCCCGGGGCAGG - Intergenic
1061299664 9:129697392-129697414 CGGCGCGGGCAGCGCGGGGCTGG + Intronic
1061828326 9:133275263-133275285 GGCGGCGGGCGGCGCGGGCCGGG - Intergenic
1061843804 9:133375814-133375836 GTCAGGGGGCGGCCCGGGCCTGG + Intronic
1061843823 9:133375866-133375888 CGGCCCGGGCGGCCTGGGTCGGG + Intronic
1061961871 9:133992692-133992714 CGCTCCGCGCGTCCCGGGCCTGG + Intergenic
1061961875 9:133992705-133992727 CGACGCGGGCGGCCCAGGCCCGG - Intergenic
1061975998 9:134068219-134068241 CCCCGCGCGCCCCCCGGGCCAGG - Intronic
1062022612 9:134326547-134326569 CGGCGCGGCCGGCCCGGGCCCGG - Intronic
1062230684 9:135479995-135480017 CGCGGCGGGCGGCGGGGGACGGG + Exonic
1062230795 9:135480304-135480326 GGCAGCGGCCGCCCCGGGCCGGG - Intronic
1062340209 9:136090786-136090808 CCCCGAGGGCAGCCCGGCCCTGG - Intronic
1062392308 9:136338726-136338748 CGCGGCGGGCAGACCCGGCCCGG + Intronic
1062394730 9:136348217-136348239 CACTGCGGGCAGCCCAGGCCAGG - Intronic
1062461971 9:136665970-136665992 GGCCGGGGGCGGAGCGGGCCGGG + Intronic
1062467679 9:136688203-136688225 CGCCGGGTGGGGGCCGGGCCAGG - Intergenic
1062493660 9:136821647-136821669 CGCGGCGGGAGGCCCGAGACGGG - Intronic
1062646827 9:137552003-137552025 CGCCGCGCGCGGCCAGGGGCGGG + Intronic
1203471566 Un_GL000220v1:117343-117365 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1203479387 Un_GL000220v1:161315-161337 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1186973399 X:14873556-14873578 CGCCGCTGGCCCCCCGGACCCGG + Intronic
1188542661 X:31266963-31266985 CGGCGCGGGCGGGCCGGGGAGGG + Intronic
1189534526 X:41923205-41923227 GAGCGAGGGCGGCCCGGGCCCGG + Intronic
1190024665 X:46912540-46912562 CGCGGGGGGCGGCCCCGGCGGGG + Exonic
1190881550 X:54495681-54495703 CCCCGCGCGGGGCCGGGGCCGGG - Exonic
1195239511 X:102937324-102937346 CGCCCCGGGCAGCCCCGACCAGG + Exonic
1195298195 X:103500729-103500751 CGCCCCGGGCAGCCCCGACCAGG - Exonic
1195370262 X:104166469-104166491 CGCAGTGGGCGGGGCGGGCCTGG + Intergenic
1196684069 X:118495886-118495908 GGCCGCGGCCGCCGCGGGCCGGG + Intronic
1196735183 X:118976228-118976250 GGCCGCGAGCGGCCCGGGTCGGG + Intronic
1196804742 X:119574396-119574418 CCCCACGGGAGGCCCGGGGCGGG - Intergenic
1196965113 X:121047430-121047452 CGCCGCGGCCTCGCCGGGCCTGG - Intergenic
1196965195 X:121047707-121047729 CGCTGCTGCCGTCCCGGGCCGGG + Exonic
1198270516 X:135052049-135052071 CGCCGCGGGCCGGAGGGGCCCGG + Exonic
1199772643 X:150984155-150984177 CGGCGCCCGCGGCCCGGGGCGGG + Intronic
1199772702 X:150984308-150984330 GCCCCCGGGCGGCCCGGGCGGGG + Intronic
1200076835 X:153555333-153555355 CGCCGCAGGCTCCCCAGGCCTGG + Intronic
1200147630 X:153934833-153934855 CGCCGCGTGGGCGCCGGGCCGGG - Intronic
1200163284 X:154019853-154019875 GGCCGCGGCGGGCGCGGGCCTGG + Exonic
1200211508 X:154348751-154348773 CGGCCAGGGCGGCCTGGGCCGGG + Exonic
1200213979 X:154359378-154359400 TGGCACGGGCGGCCTGGGCCTGG - Exonic
1200787547 Y:7273748-7273770 CCCCGGGGGCGCCCCGGGCGCGG + Intergenic