ID: 1180020837

View in Genome Browser
Species Human (GRCh38)
Location 21:45125574-45125596
Sequence CAGCAGGCGGGTGACTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180020837_1180020844 -10 Left 1180020837 21:45125574-45125596 CCAGAGCAGTCACCCGCCTGCTG No data
Right 1180020844 21:45125587-45125609 CCGCCTGCTGGGACTCATTGGGG No data
1180020837_1180020847 14 Left 1180020837 21:45125574-45125596 CCAGAGCAGTCACCCGCCTGCTG No data
Right 1180020847 21:45125611-45125633 AAGTAAGATCTTCCCACACAAGG No data
1180020837_1180020848 19 Left 1180020837 21:45125574-45125596 CCAGAGCAGTCACCCGCCTGCTG No data
Right 1180020848 21:45125616-45125638 AGATCTTCCCACACAAGGACAGG No data
1180020837_1180020845 -9 Left 1180020837 21:45125574-45125596 CCAGAGCAGTCACCCGCCTGCTG No data
Right 1180020845 21:45125588-45125610 CGCCTGCTGGGACTCATTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180020837 Original CRISPR CAGCAGGCGGGTGACTGCTC TGG (reversed) Intronic