ID: 1180020841

View in Genome Browser
Species Human (GRCh38)
Location 21:45125586-45125608
Sequence CCCAATGAGTCCCAGCAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180020841_1180020847 2 Left 1180020841 21:45125586-45125608 CCCGCCTGCTGGGACTCATTGGG No data
Right 1180020847 21:45125611-45125633 AAGTAAGATCTTCCCACACAAGG No data
1180020841_1180020848 7 Left 1180020841 21:45125586-45125608 CCCGCCTGCTGGGACTCATTGGG No data
Right 1180020848 21:45125616-45125638 AGATCTTCCCACACAAGGACAGG No data
1180020841_1180020851 22 Left 1180020841 21:45125586-45125608 CCCGCCTGCTGGGACTCATTGGG No data
Right 1180020851 21:45125631-45125653 AGGACAGGAGAGTCACATTGTGG No data
1180020841_1180020852 30 Left 1180020841 21:45125586-45125608 CCCGCCTGCTGGGACTCATTGGG No data
Right 1180020852 21:45125639-45125661 AGAGTCACATTGTGGCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180020841 Original CRISPR CCCAATGAGTCCCAGCAGGC GGG (reversed) Intronic