ID: 1180020843

View in Genome Browser
Species Human (GRCh38)
Location 21:45125587-45125609
Sequence CCCCAATGAGTCCCAGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180020843_1180020848 6 Left 1180020843 21:45125587-45125609 CCGCCTGCTGGGACTCATTGGGG No data
Right 1180020848 21:45125616-45125638 AGATCTTCCCACACAAGGACAGG No data
1180020843_1180020847 1 Left 1180020843 21:45125587-45125609 CCGCCTGCTGGGACTCATTGGGG No data
Right 1180020847 21:45125611-45125633 AAGTAAGATCTTCCCACACAAGG No data
1180020843_1180020852 29 Left 1180020843 21:45125587-45125609 CCGCCTGCTGGGACTCATTGGGG No data
Right 1180020852 21:45125639-45125661 AGAGTCACATTGTGGCCATCAGG No data
1180020843_1180020851 21 Left 1180020843 21:45125587-45125609 CCGCCTGCTGGGACTCATTGGGG No data
Right 1180020851 21:45125631-45125653 AGGACAGGAGAGTCACATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180020843 Original CRISPR CCCCAATGAGTCCCAGCAGG CGG (reversed) Intronic