ID: 1180020851

View in Genome Browser
Species Human (GRCh38)
Location 21:45125631-45125653
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180020846_1180020851 18 Left 1180020846 21:45125590-45125612 CCTGCTGGGACTCATTGGGGGAA No data
Right 1180020851 21:45125631-45125653 AGGACAGGAGAGTCACATTGTGG No data
1180020841_1180020851 22 Left 1180020841 21:45125586-45125608 CCCGCCTGCTGGGACTCATTGGG No data
Right 1180020851 21:45125631-45125653 AGGACAGGAGAGTCACATTGTGG No data
1180020843_1180020851 21 Left 1180020843 21:45125587-45125609 CCGCCTGCTGGGACTCATTGGGG No data
Right 1180020851 21:45125631-45125653 AGGACAGGAGAGTCACATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type