ID: 1180020852

View in Genome Browser
Species Human (GRCh38)
Location 21:45125639-45125661
Sequence AGAGTCACATTGTGGCCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180020850_1180020852 -8 Left 1180020850 21:45125624-45125646 CCACACAAGGACAGGAGAGTCAC No data
Right 1180020852 21:45125639-45125661 AGAGTCACATTGTGGCCATCAGG No data
1180020841_1180020852 30 Left 1180020841 21:45125586-45125608 CCCGCCTGCTGGGACTCATTGGG No data
Right 1180020852 21:45125639-45125661 AGAGTCACATTGTGGCCATCAGG No data
1180020843_1180020852 29 Left 1180020843 21:45125587-45125609 CCGCCTGCTGGGACTCATTGGGG No data
Right 1180020852 21:45125639-45125661 AGAGTCACATTGTGGCCATCAGG No data
1180020849_1180020852 -7 Left 1180020849 21:45125623-45125645 CCCACACAAGGACAGGAGAGTCA No data
Right 1180020852 21:45125639-45125661 AGAGTCACATTGTGGCCATCAGG No data
1180020846_1180020852 26 Left 1180020846 21:45125590-45125612 CCTGCTGGGACTCATTGGGGGAA No data
Right 1180020852 21:45125639-45125661 AGAGTCACATTGTGGCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180020852 Original CRISPR AGAGTCACATTGTGGCCATC AGG Intronic