ID: 1180027457

View in Genome Browser
Species Human (GRCh38)
Location 21:45175928-45175950
Sequence CAGGGCGTTCTTGGGGAGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180027457_1180027464 3 Left 1180027457 21:45175928-45175950 CCGTCCTCCCCAAGAACGCCCTG 0: 1
1: 0
2: 1
3: 13
4: 248
Right 1180027464 21:45175954-45175976 CAGCTGAATGAGATCAAGCCTGG 0: 1
1: 0
2: 1
3: 10
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180027457 Original CRISPR CAGGGCGTTCTTGGGGAGGA CGG (reversed) Exonic
900475495 1:2874547-2874569 CAGAGGGGTCTAGGGGAGGATGG + Intergenic
900831616 1:4969671-4969693 CAGGGAGGTCATGGGGAGGCTGG + Intergenic
901138647 1:7013743-7013765 CATTGTGTTCTTGGTGAGGAGGG + Intronic
901438298 1:9262744-9262766 CAGGGCTTTCTGGGAGAGGCTGG + Intronic
901838570 1:11939475-11939497 CTGGGACTGCTTGGGGAGGAGGG + Intronic
902730315 1:18364796-18364818 CAGGGAGGTCCTGGGGATGAGGG - Intronic
907310959 1:53538764-53538786 CAGTGTGTTCCTGGTGAGGAAGG - Intronic
910206239 1:84751602-84751624 CAGGGTGGTGGTGGGGAGGAGGG - Intergenic
910958271 1:92731461-92731483 CATTGTGTTCATGGGGAGGAAGG + Intronic
912045604 1:105451383-105451405 CAGTGAGTTATTGGGGATGAGGG + Intergenic
913715118 1:121526035-121526057 GAGGGTGTTCTTGGGAGGGAAGG + Intergenic
915318915 1:155045377-155045399 CAGGGTGTATTGGGGGAGGATGG + Intronic
915571383 1:156747059-156747081 CTGGGCCTTCCTGGGGGGGAAGG - Intronic
915625090 1:157109550-157109572 CAGGGCCTTCCTGAAGAGGAGGG - Intergenic
915737352 1:158093503-158093525 CAGGCAGTGCTTGGGGTGGATGG + Intronic
917659599 1:177164518-177164540 CAGGTCGTTCTCGCGCAGGAAGG + Exonic
918404852 1:184201574-184201596 TAGGGTGTTCTTCTGGAGGAGGG - Intergenic
918433545 1:184487027-184487049 CAAGGCCTGCTTGGGGATGAGGG + Intronic
920211302 1:204330803-204330825 CAGGGTGATCTAGGGAAGGAGGG - Intronic
920303868 1:205006501-205006523 CTGGGCTTTCTTGGGCAGGAGGG + Intronic
920705834 1:208249743-208249765 CAGGGCTTTCTCGGGGTGGGGGG + Intergenic
920867814 1:209767978-209768000 TAGGGGGTTGGTGGGGAGGAGGG - Intronic
921172117 1:212559043-212559065 CAGCGCGTTCTTGGCGAGTGGGG - Intergenic
922033270 1:221824922-221824944 GAGGGAGTTGCTGGGGAGGAGGG - Intergenic
922909660 1:229204996-229205018 CAGGGCCTTTTGGGAGAGGAAGG + Intergenic
922913702 1:229238871-229238893 CAGGGCGCTCGGGAGGAGGAAGG - Intergenic
923019434 1:230151520-230151542 CAGGGCTATCTTGGGGAGGCCGG - Intronic
924106510 1:240654497-240654519 CAGGGAGTTCTCCTGGAGGAGGG - Intergenic
1062905243 10:1175456-1175478 GAGGGCCTTTTTGGGTAGGAGGG + Intergenic
1063898682 10:10709422-10709444 CAGGGTGGGCGTGGGGAGGAAGG - Intergenic
1067477142 10:46574582-46574604 CAGGTCCTTCTTTGTGAGGAGGG - Intergenic
1067576634 10:47412907-47412929 CAGGGAGCTCCTGGGGAGGGCGG - Intergenic
1067617597 10:47767199-47767221 CAGGTCCTTCTTTGTGAGGAGGG + Intergenic
1069936612 10:71921869-71921891 CAGGGCCAGCTTGGGCAGGAGGG - Intergenic
1070727287 10:78801193-78801215 GAGTGCGTTCGTGGGAAGGATGG - Intergenic
1072518290 10:96208279-96208301 CAGGGAGCTGTTGGGGAAGAGGG - Intronic
1072804825 10:98417717-98417739 CAGGAGCTTCCTGGGGAGGAAGG + Exonic
1073244676 10:102081318-102081340 CAGTGTGTTAGTGGGGAGGATGG - Intergenic
1074149029 10:110741818-110741840 CAGGGCTCTCCTGGGGAGGGAGG - Intronic
1074377571 10:112951874-112951896 CAGGGCTTTGTTGGTGGGGAGGG + Intronic
1074552738 10:114460145-114460167 AGGAGCGTTCCTGGGGAGGAGGG + Intronic
1074578872 10:114697072-114697094 CAGGGCACTCTGGGGGAGGAAGG + Intergenic
1076134511 10:128036250-128036272 GTGGGGGTTATTGGGGAGGAAGG - Intronic
1080870395 11:36231735-36231757 CAGGGTTTTTTTGGGGGGGAGGG + Exonic
1082772566 11:57219751-57219773 CAGGGAGTTCTTTAGGTGGAGGG - Intergenic
1083300119 11:61735725-61735747 CAGGGCATCCTTGGGGAGAGAGG - Exonic
1083792898 11:64997198-64997220 GAGGGTGTTCTAGGGGAGGGAGG + Intergenic
1083945271 11:65919711-65919733 AAGGGGGTGCTGGGGGAGGAAGG - Intronic
1084383497 11:68828291-68828313 CAGGGGCTTCTTGGAGAGGGGGG + Intronic
1086582381 11:88414163-88414185 CAGGGTGGTGGTGGGGAGGATGG - Intergenic
1086972666 11:93100379-93100401 CAGGGCCTGCATGGGGAGGGTGG - Intergenic
1089005538 11:115087732-115087754 CTGGGGCTTCTCGGGGAGGAAGG + Intergenic
1089278453 11:117355655-117355677 CAGGGAGTTCCTGGGGAAGGTGG + Intronic
1089456917 11:118631194-118631216 GCTGGCGTTCCTGGGGAGGATGG - Exonic
1090076741 11:123584497-123584519 CAGGGCAGCCTTGGGGAGGGAGG + Intronic
1091026927 11:132149734-132149756 AAGGGCATCCTGGGGGAGGAGGG + Intronic
1091941909 12:4493206-4493228 CCTGTCGTTTTTGGGGAGGAGGG + Intronic
1095319260 12:40806211-40806233 CTTGGCCTTCATGGGGAGGAGGG - Intronic
1096748212 12:53742446-53742468 CAGATCATTCTTTGGGAGGAGGG + Intergenic
1097241765 12:57580573-57580595 CAGGGCGGCCATGGGGATGAGGG - Intronic
1099200304 12:79668522-79668544 CAGGGGGATAATGGGGAGGATGG + Intronic
1100621420 12:96278512-96278534 CAGTTCTTTCTTGGGGATGAAGG - Exonic
1101062376 12:100985653-100985675 GAGGGTTCTCTTGGGGAGGAGGG + Intronic
1102644079 12:114392608-114392630 CTGGGCTTTCTTGGGGTAGAGGG + Intronic
1103729053 12:123013875-123013897 CAGGGCTGCCTTGGGCAGGATGG + Exonic
1104054415 12:125218516-125218538 CATGGCATTCTGGGGTAGGAGGG + Intronic
1104682727 12:130762429-130762451 CAGGGAGTGCCTGGGGAGGGTGG + Intergenic
1104935359 12:132361412-132361434 CAGGGCCGCCTTGGGGAGCACGG - Intergenic
1106483715 13:30155245-30155267 CGGGGTGTCCTTGAGGAGGAGGG - Intergenic
1107115332 13:36740489-36740511 ATGGATGTTCTTGGGGAGGAGGG - Intergenic
1108060014 13:46523465-46523487 CAGAGAGTTCTTGGTGAGAATGG - Intergenic
1111677162 13:91400706-91400728 CAGGGCCTTACTGGGGAGAAGGG - Intronic
1113052414 13:106228703-106228725 CAGGGCGTTCCTTCGGAGTAGGG + Intergenic
1113892438 13:113743494-113743516 AAGGGCTTCCCTGGGGAGGACGG + Intergenic
1114225384 14:20733212-20733234 CAGGTGGTTCTTAGGCAGGAAGG - Intronic
1114774028 14:25460996-25461018 CAGGGAGTTCTTGGTTTGGAGGG + Intergenic
1118128674 14:62937842-62937864 CAGTGTGTGCCTGGGGAGGAGGG + Intronic
1118381674 14:65222623-65222645 CAGGGGCCTCTGGGGGAGGATGG + Intergenic
1118990343 14:70791827-70791849 CAGGGAGCTCCTGGAGAGGAGGG + Intronic
1119554517 14:75542888-75542910 CAGAGCTTGCTTAGGGAGGAAGG + Intronic
1122483580 14:102063604-102063626 CAGTCCATTCTTGGGGAGGGAGG - Intergenic
1122817068 14:104319145-104319167 CAGAGGGCTCTGGGGGAGGAAGG - Intergenic
1122946671 14:105014161-105014183 CAGGGAGATCTTGGGGGTGAGGG + Intronic
1129769079 15:78192290-78192312 CAGTGTGGCCTTGGGGAGGATGG - Intronic
1130923398 15:88367384-88367406 CAGGGAGTTCTGGGGGACGCAGG - Intergenic
1132027821 15:98417892-98417914 CTGGGTGTCCCTGGGGAGGATGG - Intergenic
1132610974 16:816206-816228 CTGGGCGGTTTTGAGGAGGAAGG + Intergenic
1132737778 16:1395599-1395621 CAGGAGGTTCCTGGGGCGGAAGG - Intronic
1132745310 16:1433882-1433904 GAGGGCTTTCTTGGAGAGGCAGG + Intergenic
1132828713 16:1917447-1917469 CTCGGGGGTCTTGGGGAGGAAGG + Intronic
1133433981 16:5763482-5763504 CAGGAGGCTCTTGGGGATGAAGG + Intergenic
1134090122 16:11387063-11387085 CAGGGGGCTCTCAGGGAGGAGGG + Intronic
1134517040 16:14895632-14895654 CAAGGCGGACTTGAGGAGGAAGG + Exonic
1135908174 16:26533190-26533212 CAAGTGGTTCTTGGGGTGGAGGG - Intergenic
1137733793 16:50709558-50709580 CATGGGGTGCATGGGGAGGATGG + Intronic
1137886248 16:52106954-52106976 CATGGAGTTCTTGGGGACAAGGG - Intergenic
1139384081 16:66552922-66552944 CATGGCCTCCTTGGGGAAGAAGG + Intronic
1139488434 16:67272214-67272236 CAGGGGGTTCTTAGGGTGGGGGG + Intergenic
1141075618 16:81004409-81004431 CAGGGACTGCCTGGGGAGGAAGG + Intronic
1141268548 16:82518806-82518828 CAGGGCCTGCTTGGCAAGGAAGG + Intergenic
1143286420 17:5793087-5793109 CAGGGTATACTTGGGTAGGAAGG + Intronic
1144153539 17:12474680-12474702 CAGGGCTTTCTTTGGTTGGAAGG + Intergenic
1147308771 17:39581402-39581424 CATGGGGTTCGTGCGGAGGATGG + Intergenic
1147983847 17:44292818-44292840 CAGTGGGTTCCTGGGAAGGATGG + Intergenic
1149560467 17:57604703-57604725 CAGGGGATTCTGGGGAAGGAAGG + Intronic
1150319162 17:64196489-64196511 CCGGTCATTCTTTGGGAGGAGGG - Intronic
1151405594 17:73884208-73884230 CCGGGAGTTCATGGGGAGGAGGG - Intergenic
1152407320 17:80105059-80105081 CAGGATGTCCTTGGGGAAGAAGG - Intergenic
1152490748 17:80631509-80631531 CCGGGCTTTCTCGGAGAGGACGG + Intronic
1153976591 18:10273467-10273489 CAGAACATGCTTGGGGAGGAAGG + Intergenic
1154198666 18:12284442-12284464 CACGGGGATCTTGGGGAGAAGGG - Intergenic
1158531743 18:58268849-58268871 GAGGAAGTCCTTGGGGAGGAGGG + Intronic
1161767810 19:6216693-6216715 CAGGGCGTTCTAGGGGAAGCGGG - Intronic
1162034916 19:7933561-7933583 CAGGGCCTCCCTGGGGAAGAGGG + Exonic
1163604023 19:18264480-18264502 CGAGGCGGCCTTGGGGAGGATGG + Exonic
1163701371 19:18788371-18788393 CGGGGCGGGCTTGGGCAGGAGGG - Intronic
1164455611 19:28404134-28404156 CAGGGTGTACATGGGGAGGCTGG + Intergenic
1164753478 19:30672752-30672774 CAGGCAGTTTTTTGGGAGGAGGG + Intronic
1165240399 19:34462205-34462227 CAGGGAGCTATTAGGGAGGAGGG + Intronic
1165855599 19:38877993-38878015 CAGGGTGTTATTAGGAAGGAGGG + Intronic
1166668414 19:44695462-44695484 GAGGTTGTTCTTGGGGAGAAAGG - Intergenic
1168712806 19:58511547-58511569 CAGGGCACTCTTGGTGTGGACGG - Exonic
925033137 2:666739-666761 CAAGTCGGTCCTGGGGAGGACGG - Intergenic
925640852 2:5984991-5985013 GAGGGCGTTGGTAGGGAGGAAGG - Intergenic
926120716 2:10239925-10239947 CAGGGTGCTGTTGGGGAGGAAGG + Intergenic
926293255 2:11547875-11547897 CAGTGTGTTCTTGGGGTAGAAGG - Intronic
926737307 2:16083297-16083319 GAGGGGCTTCCTGGGGAGGAAGG - Intergenic
926855374 2:17250810-17250832 CAGGGTGTGCTTGATGAGGAGGG - Intergenic
935330362 2:101973194-101973216 CATGGCGCCCTTGAGGAGGAGGG + Intergenic
935376758 2:102408053-102408075 CTGGGGGTTCTTAGGGAGGAGGG + Intergenic
935885047 2:107608595-107608617 CAGGGTGTTTTGGGGGAGTAAGG + Intergenic
936061743 2:109299206-109299228 CAGGCAGTCCTTGGGGAGGCAGG - Intronic
939170506 2:138689739-138689761 CAGTGTGTTATTGGGGAGGGAGG + Intronic
941587290 2:167376470-167376492 CAGGGCTTTCTTGGGTTGGTAGG + Intergenic
942749194 2:179268722-179268744 GAGGGTGTTCATGGGCAGGAAGG + Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
946192287 2:218013916-218013938 CAGGGCAAACTTGGGGAGAAGGG - Intergenic
946983534 2:225246416-225246438 CAGGGCCTTCTTCAGGATGAAGG - Intergenic
947214353 2:227736449-227736471 GAGGGCATTCCTTGGGAGGAGGG + Intergenic
947526181 2:230878102-230878124 CAGGGGGTTCTGGGGGAGGAGGG - Exonic
948560722 2:238849328-238849350 CAGGGTTTGCCTGGGGAGGACGG + Intronic
948803576 2:240443535-240443557 CAGGGCTGTGGTGGGGAGGAGGG + Intronic
948994061 2:241569945-241569967 CAGGTAGTTCTTGGGCAGGCAGG - Intronic
1169393078 20:5205933-5205955 AAGGGAGTTCTTGGGAATGAAGG + Intergenic
1170530672 20:17287984-17288006 CAGGGCGTTCTGGGACAGAAAGG - Intronic
1171767109 20:29296517-29296539 CAGAGGGGTGTTGGGGAGGAGGG + Intergenic
1171908838 20:30922238-30922260 CAGAGGGGTGTTGGGGAGGAGGG - Intergenic
1172899829 20:38326386-38326408 CAGGGAGGAGTTGGGGAGGACGG - Exonic
1173128525 20:40364246-40364268 CATGGCTTTCTTGGGGTGGAGGG - Intergenic
1173543182 20:43869742-43869764 TAGGGCTTTCTTGGGGAGCAGGG - Intergenic
1174037240 20:47675760-47675782 CAGGGCAGGCTTGGAGAGGAGGG - Intronic
1174258540 20:49277382-49277404 CAGGGGGTGCTTGCTGAGGACGG + Intronic
1175525258 20:59629318-59629340 CAGGGCCTTCCTGGGAAGAAGGG - Intronic
1176161993 20:63652914-63652936 CAGAGCCTTCGTGGGGAGGCGGG - Intronic
1177223626 21:18224898-18224920 CAGGGCGGCCTTAGGGAGGCTGG + Intronic
1178271420 21:31193405-31193427 CAGGGCTTTTCTGGGGAGGCTGG - Intronic
1180027457 21:45175928-45175950 CAGGGCGTTCTTGGGGAGGACGG - Exonic
1180115175 21:45698481-45698503 CAGGGCTCTCTTGGGGAGAAGGG + Intronic
1180181701 21:46121094-46121116 CAGGGAGCTCTTGGGGAGCCCGG + Exonic
1180604702 22:17048648-17048670 CAGGGCATTCTAGGACAGGATGG + Intergenic
1181484736 22:23223601-23223623 CAGGGGGTACTCAGGGAGGAGGG + Intronic
1183456181 22:37924563-37924585 CGGGGCGCTCCTGGGGAGGCAGG + Intronic
1183640744 22:39090895-39090917 CAGGGCTTTCTGGGGGGGTAGGG + Intergenic
1183735709 22:39643729-39643751 CAGTGCTTTCTTGGGGAGGCTGG + Intronic
1184189501 22:42885498-42885520 CAGGGCCTTCTGAGGAAGGATGG + Intronic
1184248838 22:43249013-43249035 CAGGGGGTGCTGGTGGAGGAAGG + Intronic
1184747313 22:46463849-46463871 CAGGCCGTTGATGGGGTGGATGG + Exonic
1184923554 22:47622411-47622433 CAGGGCCAGATTGGGGAGGAAGG + Intergenic
950691468 3:14661678-14661700 CACTGGGGTCTTGGGGAGGAGGG - Exonic
951925906 3:27908589-27908611 TAGGGAGGTCTTGGGGAGCAGGG - Intergenic
952962704 3:38602754-38602776 CAGAGCGCACTTGGAGAGGAAGG - Intronic
954104732 3:48403898-48403920 CAGGGGGGTCTTGGGGAGAGTGG - Exonic
954135552 3:48580588-48580610 CAGGGAGATCCTGGAGAGGATGG - Exonic
954687533 3:52378855-52378877 CAGGGCCTGTTTGGGCAGGAAGG - Intronic
958034072 3:88149730-88149752 CAAGGCGCTCTTTTGGAGGAGGG + Exonic
958086522 3:88815691-88815713 CAGGGAGTTCATGGAGAGAATGG + Intergenic
964763798 3:160158935-160158957 CAGGGTATTCTAGGAGAGGAAGG + Intergenic
968213317 3:196867740-196867762 CAGCGCGTTCTGAGGGAGGCCGG + Intergenic
969327390 4:6451888-6451910 CAGGCCCTTCTTGGGGGTGAGGG - Intronic
973196542 4:47449437-47449459 CATGGTGGACTTGGGGAGGAAGG + Intergenic
974146657 4:57956273-57956295 CATGGGGTTTTTGGGGATGAAGG + Intergenic
975732811 4:77354196-77354218 TAGGGCTGGCTTGGGGAGGAGGG - Intronic
975734402 4:77367292-77367314 TAGGGCTGGCTTGGGGAGGAGGG - Intronic
982179770 4:152739166-152739188 CAGAACCTTCTTGGGGAGCATGG - Intronic
984177939 4:176442317-176442339 CAGTGCTTTCTTGAGAAGGAAGG + Intergenic
985006881 4:185543038-185543060 CAGGGAGTTCTTGGTTTGGACGG + Intergenic
985697310 5:1347879-1347901 CCGGGCTTTCCTGGGGAGGAAGG + Intergenic
989222101 5:38978109-38978131 CAGGGTGTTTTTGGAGAGAAAGG - Intronic
990515805 5:56529958-56529980 CAGGGCCTGCTTGTGGAGAAGGG - Intronic
990996489 5:61737085-61737107 CAGGGTGCAGTTGGGGAGGAAGG + Intronic
992202882 5:74401490-74401512 AAGGAAGCTCTTGGGGAGGATGG - Intergenic
992944070 5:81792341-81792363 AAGGGCGTTCCTGGAGTGGAAGG - Intergenic
994057250 5:95431848-95431870 GATTGTGTTCTTGGGGAGGAAGG - Intronic
999306132 5:150520943-150520965 CAGGGCCTTCTGGGGGTGCAGGG - Exonic
1002456209 5:179346381-179346403 CAGGGCCTTGCTGGAGAGGAGGG - Intergenic
1002783580 6:384694-384716 CAGGGCGTGCTGTGGGAGAAGGG + Intergenic
1003348447 6:5293197-5293219 CAGTGCCTTCTTGGGAAAGAAGG + Intronic
1004148124 6:13089195-13089217 CAGGGGCTTCTTGTGGTGGAGGG - Intronic
1005703089 6:28423478-28423500 CCTGGAGTTCTTGGGCAGGATGG + Intergenic
1005861512 6:29906039-29906061 CGGGGCGATGTGGGGGAGGAGGG + Intergenic
1005946942 6:30602191-30602213 CAGGGCCTTCATGGGGACGATGG + Exonic
1007398845 6:41592243-41592265 CTGGGCGCTGGTGGGGAGGAGGG - Intronic
1013356255 6:109348347-109348369 CAGGGGGTTCCTAGGGAGAATGG - Intergenic
1015743392 6:136483346-136483368 CAGGGCCTTCTTGAGGGTGAAGG + Intronic
1017776197 6:157682713-157682735 CAGGGGGTTCTGGGGCTGGAGGG - Intergenic
1018727322 6:166623696-166623718 CAGAGCTCTCTTGGGGATGAGGG + Intronic
1019210662 6:170401992-170402014 CAGGGAGTCCTGAGGGAGGATGG - Intronic
1019286109 7:223955-223977 CAGGACGGTCCTGGGGTGGAGGG - Intronic
1019501548 7:1367247-1367269 CAGGGGATTCCTGGGAAGGAGGG - Intergenic
1019659556 7:2216416-2216438 CAGGACGTTCTGGGAAAGGAAGG + Intronic
1023990180 7:45124096-45124118 CAGGGGGGTGGTGGGGAGGAGGG + Intergenic
1025992325 7:66505402-66505424 CAGGTCCTTCTTGTTGAGGAAGG + Intergenic
1026110996 7:67458881-67458903 CAGGGGGTTCTTGCCGAGGTGGG + Intergenic
1027906794 7:84195514-84195536 CAGGGGGTTTGTTGGGAGGAGGG - Intronic
1029055074 7:97732946-97732968 CAGGGAGTTCCTGGGCCGGACGG - Intronic
1029365156 7:100111991-100112013 CAGGGCTTCCTGTGGGAGGAGGG + Exonic
1029483148 7:100824818-100824840 CAGGGCACTCGTGGGGAGGGAGG - Intronic
1029514890 7:101018255-101018277 GAGGGAGTCCTGGGGGAGGAGGG - Intronic
1029514932 7:101018371-101018393 GAGGGAGTCCTGGGGGAGGAGGG - Intronic
1031493334 7:122416728-122416750 GAGGGGGTTGTGGGGGAGGAAGG + Intronic
1034272125 7:149808457-149808479 CAGGGCGTGTTGGGGGCGGAGGG - Intergenic
1034282193 7:149862177-149862199 CAGGGCGTTTTTGCAGAGCATGG - Exonic
1034830731 7:154305352-154305374 CAAGGCTATTTTGGGGAGGATGG - Exonic
1035176605 7:157056356-157056378 TAGGGGCCTCTTGGGGAGGAGGG + Intergenic
1035677064 8:1463441-1463463 AAGGGAGTTCCTGGGGAGCATGG - Intergenic
1035724161 8:1814120-1814142 CAGGAGGTGCTAGGGGAGGATGG - Intergenic
1035724171 8:1814163-1814185 CAGGAGGTGCTAGGGGAGGATGG - Intergenic
1035842329 8:2826290-2826312 CACGGAGTCCTTAGGGAGGAAGG + Intergenic
1035982863 8:4392625-4392647 CAGGGGTTTTTTGGGGGGGAGGG + Intronic
1036680107 8:10865720-10865742 CAGGGCCTTGGTGGGGAGGTAGG + Intergenic
1037004139 8:13756164-13756186 TAGGGCGTTCTTCAGGAAGAAGG - Intergenic
1037530247 8:19765988-19766010 CAGCCCGTTCATGGGCAGGATGG + Intergenic
1037614892 8:20510124-20510146 CAGGGACTTCTTATGGAGGAAGG + Intergenic
1037881989 8:22578065-22578087 CAGGACGGTCTGTGGGAGGAGGG + Intergenic
1037886141 8:22597430-22597452 CATGGCGGTGGTGGGGAGGAGGG + Intronic
1038491929 8:27977628-27977650 CTGGGGGTTTTTAGGGAGGAAGG - Intronic
1039378273 8:37059463-37059485 CAGGGGATTGATGGGGAGGAGGG + Intergenic
1040561301 8:48525431-48525453 CAGGGAGCTCTTGTGGAGGCTGG + Intergenic
1045890087 8:107145737-107145759 CAGAGCTTTGTTGTGGAGGAAGG + Intergenic
1047731961 8:127735695-127735717 CAGTGCGTTCTCGGTGTGGAGGG + Intronic
1048552922 8:135450114-135450136 CTGGGACTTCATGGGGAGGAGGG + Intergenic
1049402135 8:142433196-142433218 CTGGGAGCTGTTGGGGAGGAGGG - Intergenic
1049485684 8:142858800-142858822 CCGGGCATTCCTGGAGAGGAAGG + Intronic
1051015109 9:12464640-12464662 CAGGGCTCTCTTGTGGATGATGG + Intergenic
1055693835 9:78861544-78861566 CAGGTGATTTTTGGGGAGGAAGG - Intergenic
1056168709 9:83962385-83962407 CAGGGCAGTTTTTGGGAGGAAGG + Intergenic
1059546790 9:115183902-115183924 CAGGGGGCTGTTGGGGAGGGGGG - Intronic
1059633517 9:116150722-116150744 AAGGGAGTCCCTGGGGAGGAGGG + Intergenic
1060555597 9:124505799-124505821 CTGGGCGGTCTTGGGGACAAAGG + Intronic
1061234416 9:129334323-129334345 CAGAGCCTTCAGGGGGAGGAAGG - Intergenic
1061910024 9:133717483-133717505 CATGGCCTTCTTGGGGACAACGG - Intronic
1061953444 9:133949268-133949290 CAGGGCGTCCTCGGGGAAGGAGG - Intronic
1062280716 9:135750534-135750556 CAGGGAGCTGTTGGGGAGGGTGG - Intronic
1185921675 X:4100013-4100035 CAGGGCCTACTTGAGGATGAAGG - Intergenic
1188001191 X:24983923-24983945 CAGGGAGTTTTGGGGGAGGCAGG - Intronic
1188298125 X:28475062-28475084 CAGGGCCTACTTGAGGATGAAGG + Intergenic
1189052858 X:37664720-37664742 CAGGGCCTACTTGAGGAGGGAGG - Intronic
1189931682 X:46018720-46018742 CAGGGCCTTTTGGGGGAGGTCGG - Intergenic
1192152136 X:68719017-68719039 CAAGAAGTTCTTGGGGAGGGTGG - Intronic
1192259196 X:69493968-69493990 CAGTGATTTCTTGGGGAAGAGGG + Intergenic
1195453207 X:105038701-105038723 CAGGGCTTACTTGAGGATGAAGG - Intronic
1196015141 X:110931311-110931333 CAGGGCCTACTTGGGGATGGAGG + Intergenic
1197068227 X:122260518-122260540 CAGGGCGTTGGCGGGGAGGTGGG - Intergenic