ID: 1180029719

View in Genome Browser
Species Human (GRCh38)
Location 21:45198269-45198291
Sequence AGGCTGATCAAGAAGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1082
Summary {0: 1, 1: 0, 2: 8, 3: 189, 4: 884}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180029719 Original CRISPR AGGCTGATCAAGAAGACAGA AGG Intronic
900232158 1:1565111-1565133 AGGCGGATCATGAAGGCAGGCGG + Intronic
900232161 1:1565128-1565150 AGGCGGATCATGAAGGCAGGCGG + Intronic
900382957 1:2394232-2394254 AGGCTGCTCAAGGAGACCGAGGG - Intronic
900427545 1:2587380-2587402 AGGCCGCTCCAGCAGACAGAAGG - Intronic
900458353 1:2788047-2788069 AGGCAGAACAAGAAAACACATGG + Intronic
901394063 1:8967639-8967661 GTCCTGACCAAGAAGACAGAAGG - Exonic
903779766 1:25813861-25813883 AACCTGTTCAGGAAGACAGAAGG - Exonic
904865367 1:33574734-33574756 AGGAGGATCAGGAACACAGAAGG + Intronic
905344171 1:37300277-37300299 AGACTGAAAAAGGAGACAGAGGG - Intergenic
905355228 1:37378580-37378602 AGACAGATCAACGAGACAGAAGG - Intergenic
905537132 1:38731016-38731038 AGGTTGCTCAAGAAAAAAGAAGG - Intergenic
905896839 1:41553059-41553081 AGACAGATCAACAATACAGAAGG - Intronic
906380897 1:45331707-45331729 AGGCTGTTCCAGAACACAGGTGG + Exonic
906736668 1:48136423-48136445 AGACAGATCAATGAGACAGAAGG - Intergenic
907648663 1:56271245-56271267 AGACAGATCAACGAGACAGAAGG + Intergenic
908178153 1:61576937-61576959 AGACAGATCAACGAGACAGAAGG - Intergenic
908920133 1:69180279-69180301 AGGCTGCTCAAAAAGCCAGAGGG - Intergenic
909025408 1:70476052-70476074 AGGAAAATGAAGAAGACAGAAGG - Intergenic
909230660 1:73085169-73085191 AGACAGATCAATGAGACAGAAGG - Intergenic
909396755 1:75179233-75179255 AGACAGATCAAAGAGACAGAAGG - Intergenic
909449243 1:75780161-75780183 AGACAGATCAACGAGACAGAAGG + Intronic
909513908 1:76486285-76486307 AGACAGATCAATGAGACAGAAGG - Intronic
909557275 1:76968143-76968165 AGACAGATCAACGAGACAGAAGG - Intronic
909668391 1:78161249-78161271 AGACAGATCAATGAGACAGAAGG + Intergenic
909807669 1:79892122-79892144 AGACAGATCAACGAGACAGAAGG - Intergenic
910101274 1:83580932-83580954 AGGCAAATCAAGCAGACAAAGGG - Intergenic
910281976 1:85510930-85510952 AGACAGATCAAAGAGACAGAAGG + Intronic
910319080 1:85923250-85923272 AGACAGATCAACAAGACAGAAGG + Intronic
910339114 1:86165903-86165925 AGACAGATCAACGAGACAGAAGG - Intergenic
910618609 1:89228331-89228353 AGACAGATCAATGAGACAGAAGG - Intergenic
910710011 1:90169409-90169431 AGACAGATCAACGAGACAGAAGG + Intergenic
910748350 1:90599105-90599127 AGGCTAATAAAGAAGAAAGGAGG + Intergenic
910829362 1:91444431-91444453 AGACAGATCAACAAGACAGAAGG + Intergenic
910923183 1:92371393-92371415 AGGTAGATAAATAAGACAGATGG + Intronic
910954311 1:92684985-92685007 AGACAGATCAACAAGACAGAAGG + Intronic
911128760 1:94367830-94367852 ATACAGATCAACAAGACAGAAGG - Intergenic
911170015 1:94761053-94761075 ATACAGATCAACAAGACAGAAGG + Intergenic
911534776 1:99087697-99087719 AGGCTGAACAAGAAGCATGATGG - Intergenic
911687756 1:100796643-100796665 AGGAGGATCAAGAAGAAAGCTGG + Intergenic
911867633 1:103049160-103049182 AGACAGATCAACGAGACAGAAGG - Intronic
912000953 1:104834019-104834041 AGACAGATCAATGAGACAGAAGG + Intergenic
912256593 1:108065688-108065710 GGCCTGTGCAAGAAGACAGATGG - Intergenic
912303845 1:108544438-108544460 AGACAGATCAATGAGACAGAAGG + Intergenic
912385346 1:109268635-109268657 GAGCTGATCCAGCAGACAGAGGG + Exonic
912464284 1:109859552-109859574 AGACAGATCAACGAGACAGAAGG + Intergenic
913362896 1:118002384-118002406 AGACAGATCAATGAGACAGAAGG - Intronic
913407787 1:118515333-118515355 AGGCAGATCAATGAGACAGAAGG - Intergenic
913410459 1:118545089-118545111 AGGCAGGTCAATGAGACAGAAGG + Intergenic
913526114 1:119694951-119694973 AGACAGATCAATGAGACAGAAGG - Intronic
914221999 1:145689599-145689621 AGGCTGATACAGAAGGCAGAAGG + Intronic
914388306 1:147194068-147194090 AGACAGATCAACGAGACAGAAGG - Intronic
914441175 1:147708548-147708570 AGACAGATCAACAAGACAGAAGG - Intergenic
914458964 1:147864199-147864221 AGACAGATCAACAAGACAGAAGG + Intergenic
915289354 1:154872548-154872570 AGGGAAATCAAGAATACAGAAGG - Intergenic
915711597 1:157904408-157904430 AGACAGATCAACAAGACAGAAGG + Intergenic
915759900 1:158300541-158300563 AGGCAGATCAACAAGACAGAAGG - Intergenic
915975847 1:160388161-160388183 AGACAGATCAACCAGACAGAAGG - Intergenic
916038155 1:160939403-160939425 AGACAGATCAACGAGACAGAAGG - Intergenic
916140861 1:161696413-161696435 AGACTAATAAAGAAGAGAGAGGG + Intergenic
916591155 1:166191979-166192001 AGGCTGACCAAGAAAATAGTTGG - Intergenic
916634114 1:166649657-166649679 AGGATGAAAAAGAACACAGAGGG + Intergenic
917083648 1:171283393-171283415 AGCCTGTTTAAGAAGAGAGAAGG + Intronic
917111548 1:171554028-171554050 AGACAGATCAATGAGACAGAAGG - Intronic
917162849 1:172077861-172077883 AGACAGATCAACGAGACAGAAGG - Intronic
917181675 1:172304463-172304485 AGACAGATCAACGAGACAGAAGG + Intronic
917297945 1:173541439-173541461 AGACAGATCAACAAGACAGAAGG + Intronic
917320751 1:173778847-173778869 AGGCAGATTAAGAAAAAAGAAGG - Intronic
917324144 1:173814263-173814285 AGACAGATCAACGAGACAGAAGG + Intronic
917579310 1:176358446-176358468 AGACAGATCAATGAGACAGAAGG + Intergenic
917827635 1:178840081-178840103 AGACAGATCAACAAGACAGAAGG + Intronic
918159533 1:181884788-181884810 AGACAGATGAACAAGACAGAAGG + Intergenic
918547967 1:185707382-185707404 AGGCTGAACAAAAAAAAAGATGG + Intergenic
919060369 1:192624411-192624433 AGACACATCAACAAGACAGAAGG - Intergenic
919128909 1:193430062-193430084 AGACAGATCAACGAGACAGAAGG - Intergenic
919395689 1:197044588-197044610 AGACAGATCAACGAGACAGAAGG + Intronic
920781322 1:208994009-208994031 AGACAGATCAATGAGACAGAAGG + Intergenic
920960431 1:210658529-210658551 AGACAGATCAATGAGACAGAAGG - Intronic
921004376 1:211078199-211078221 AGACAGATCAATGAGACAGAAGG + Intronic
921288241 1:213629144-213629166 AGACAGATCAATGAGACAGAAGG - Intergenic
921288731 1:213634159-213634181 AGACAGATCAATGAGACAGAAGG + Intergenic
921521737 1:216164515-216164537 AGACTGATTATGAAGACAGGGGG + Intronic
922046921 1:221954313-221954335 AGACAGATCAACAAGACAGAAGG + Intergenic
922064604 1:222124727-222124749 GGGCTAATCATAAAGACAGATGG - Intergenic
922092205 1:222406952-222406974 AGACAGATCAACAAGACAAAAGG + Intergenic
923194229 1:231649617-231649639 AGACAGATCAACAAGACAGAAGG - Intronic
923394066 1:233543443-233543465 AGGCTGATTAAGAGGATAAAAGG - Intergenic
923523340 1:234753015-234753037 AGGCTGTTGACCAAGACAGAAGG - Intergenic
923716188 1:236426543-236426565 AGGCTGATCACGAACTCACATGG - Intronic
923861534 1:237896770-237896792 AGGCTAATTAAGAGGACAGCAGG + Intergenic
924491733 1:244544719-244544741 TGGCTGGTGCAGAAGACAGATGG + Intronic
924798457 1:247309865-247309887 GGGCTGGTCCAGAAGAGAGAAGG + Intronic
1062973284 10:1664928-1664950 AGGGAAATCAAGAAAACAGATGG + Intronic
1063297106 10:4817804-4817826 AGGCTGGTGAAGAAGCCAGTTGG + Intronic
1064492632 10:15876078-15876100 AGACAGATTAACAAGACAGAAGG - Intergenic
1064599179 10:16975853-16975875 AGGCAGATCATGAAGTCAGGAGG - Intronic
1064975352 10:21108723-21108745 AGACAGATCAATGAGACAGAAGG - Intronic
1065077156 10:22091849-22091871 AGACAGATCAACGAGACAGAAGG + Intergenic
1066034948 10:31471641-31471663 AGACAGATCAACGAGACAGAAGG + Intronic
1066525179 10:36270641-36270663 AGGATGATCAAGAATTCAAATGG + Intergenic
1066532352 10:36354618-36354640 GGGCTGATCAAGAACACAGAAGG - Intergenic
1066755452 10:38707421-38707443 AGACAGATCAATGAGACAGAAGG + Intergenic
1067127380 10:43531028-43531050 AGACAGATCAACAAGACAAAAGG - Intergenic
1067193596 10:44093492-44093514 AGACAGATCAACGAGACAGAAGG + Intergenic
1067245683 10:44540427-44540449 AGGCTGATCATGAGGTCAGGAGG - Intergenic
1068126143 10:52844471-52844493 AGACAGATCAATGAGACAGAAGG - Intergenic
1068239884 10:54290977-54290999 AGACAGATCAACAAGACAGAAGG + Intronic
1068609302 10:59041411-59041433 AGACAGATCAACGAGACAGAAGG - Intergenic
1069259798 10:66380983-66381005 AGACAGATCAATGAGACAGAAGG + Intronic
1069300571 10:66901958-66901980 AGACAGATCAATGAGACAGAAGG + Intronic
1069734313 10:70643038-70643060 AGACAGATCAACGAGACAGAAGG - Intergenic
1069943380 10:71970228-71970250 AGGGGGATCAAGAGGACGGAGGG - Intronic
1070061943 10:72992150-72992172 AGACAGATCAATGAGACAGAAGG + Intergenic
1070226497 10:74513490-74513512 AAGCTGTAAAAGAAGACAGAGGG - Intronic
1070526432 10:77299681-77299703 AGCCTGCACAAGAAGACCGAGGG + Intronic
1070852095 10:79572914-79572936 AGACAGATCAATGAGACAGAAGG + Intergenic
1070936997 10:80306603-80306625 AGACAGATCAATGAGACAGAAGG + Intergenic
1070955550 10:80461135-80461157 AGTCTGATCAAGTAGACAGGAGG - Intronic
1071066492 10:81642501-81642523 AGACAGATCAAAGAGACAGAAGG - Intergenic
1071193733 10:83133016-83133038 AGACAGATCAACAAGACAGAAGG - Intergenic
1071421284 10:85502610-85502632 AGACAGATCAATGAGACAGAAGG - Intergenic
1071698240 10:87901389-87901411 AGACAGATCAACGAGACAGAAGG - Intronic
1071838818 10:89447187-89447209 AGACAGATCAACGAGACAGAAGG + Intronic
1071922662 10:90369355-90369377 AGACAGATCAATGAGACAGAAGG - Intergenic
1071946291 10:90648972-90648994 AGACAGATCAACGAGACAGAAGG - Intergenic
1072364794 10:94698061-94698083 AGACAGATCAAGGAGACAGAAGG + Intronic
1072389339 10:94967248-94967270 AGACAGATCAATGAGACAGAAGG - Intronic
1072401635 10:95108828-95108850 AGACAGATCAATGAGACAGAAGG - Intergenic
1072477366 10:95775700-95775722 AGACAGATCAATGAGACAGAAGG - Intronic
1072480306 10:95805050-95805072 AGACAGATCAACGAGACAGAAGG - Intronic
1072515988 10:96183875-96183897 AGACAGATCAACGAGACAGAAGG - Intronic
1072557767 10:96536681-96536703 AGGCTGAGGAAGAAGAAGGAGGG - Intronic
1072735015 10:97873402-97873424 AGGCTGACACAGAAGAAAGAGGG - Intronic
1072774829 10:98180624-98180646 AGACAGATCAACGAGACAGAAGG - Intronic
1073085309 10:100884486-100884508 AGGCCAACCAAGAAGACAGTAGG + Intergenic
1074501957 10:114033735-114033757 AGGATGATGCAGAAGGCAGAGGG - Intergenic
1074623704 10:115154271-115154293 AGACAGATCAATGAGACAGAAGG - Intronic
1075464600 10:122642245-122642267 AGGAGGCTCTAGAAGACAGAAGG + Intronic
1075585261 10:123652637-123652659 AAGCTGATCAAGAGGGGAGAAGG + Intergenic
1075805114 10:125182514-125182536 AGACAGATCAACGAGACAGAAGG - Intergenic
1077742011 11:4856652-4856674 AGACAGATCAATGAGACAGAAGG + Intronic
1077918196 11:6624581-6624603 GGGCTTATAATGAAGACAGAGGG + Intronic
1077969815 11:7177534-7177556 AGACAGATCAACGAGACAGAAGG - Intergenic
1078346278 11:10552191-10552213 CTGCTGAACAAGGAGACAGAAGG + Intergenic
1078482863 11:11694124-11694146 AAACAGATCAACAAGACAGAAGG + Intergenic
1078887125 11:15512573-15512595 AAACTGATCAAGAAAAAAGAGGG - Intergenic
1078981405 11:16538905-16538927 AGACAGATCAACGAGACAGAAGG + Intronic
1078994284 11:16681039-16681061 AGACAGATTAACAAGACAGAAGG + Intronic
1079271617 11:18992247-18992269 AGACAGATCAATGAGACAGAAGG - Intergenic
1079653769 11:22963468-22963490 AGACAGATCAATGAGACAGAAGG - Intergenic
1080131751 11:28803568-28803590 AGGATGATCAGAAAGATAGAAGG - Intergenic
1080235605 11:30065197-30065219 AGACAGATCAATGAGACAGAAGG - Intergenic
1080346614 11:31332942-31332964 AGACAGATCAATGAGACAGAAGG - Intronic
1080744195 11:35093221-35093243 AGACAGATCAATGAGACAGAAGG + Intergenic
1080817948 11:35777016-35777038 AGACAGATCAACGAGACAGAAGG - Intronic
1081241188 11:40708769-40708791 AGACAGATCAACAAGACAGAAGG - Intronic
1081313424 11:41601462-41601484 AGACAGATCAATGAGACAGAAGG + Intergenic
1081324124 11:41725358-41725380 AGACAGATCAATGAGACAGAAGG - Intergenic
1082136687 11:48557136-48557158 AGACAGATCAATGAGACAGAAGG - Intergenic
1082196348 11:49311306-49311328 AGACAGATCAATGAGACAGAAGG - Intergenic
1082777610 11:57259517-57259539 TGGCTGAACAGGTAGACAGAGGG + Intergenic
1082860457 11:57850420-57850442 AGACAGATCAATGAGACAGAAGG + Intergenic
1082876857 11:57997725-57997747 AGACAGATCAACGAGACAGAAGG - Intergenic
1083008840 11:59374629-59374651 AGACAGATCAATGAGACAGAAGG + Intergenic
1083385258 11:62304211-62304233 AGACAGATCAACAAGACAGAAGG - Intergenic
1083503213 11:63130835-63130857 AGACAGATCAATGAGACAGAAGG - Intronic
1083590676 11:63892138-63892160 AGGTTGATGAGGAAGAGAGAAGG + Intronic
1084068932 11:66721329-66721351 AGGTAGGGCAAGAAGACAGAAGG - Exonic
1085161573 11:74352442-74352464 AGCCTGATCAATAAGACATTAGG + Intronic
1085536311 11:77221793-77221815 AGACAGATCAACGAGACAGAAGG - Intronic
1085719217 11:78898265-78898287 AGGAGGATGAAGAAGAGAGAGGG - Intronic
1085800956 11:79588684-79588706 AGACAGATCAACAAGACAGAAGG + Intergenic
1086442303 11:86840540-86840562 AGACAGATCAACAAGACAGAAGG + Intronic
1086612625 11:88776001-88776023 AGACAGATCAACAAGACAGAAGG - Intronic
1086659478 11:89396899-89396921 AGACAGATCAATGAGACAGAAGG + Intronic
1086832030 11:91577846-91577868 AGACAGATCAACGAGACAGAAGG + Intergenic
1087004935 11:93460634-93460656 AGACACATCAACAAGACAGAAGG + Intergenic
1087653790 11:100899403-100899425 AGACAGAACAAGGAGACAGAAGG - Intronic
1087719089 11:101641466-101641488 AGACAGATCAAGGAGACAGAAGG + Intronic
1087898520 11:103613914-103613936 AGACAGATCAATGAGACAGAAGG + Intergenic
1088004412 11:104923737-104923759 AGACAGATCAACAAGACAGAAGG - Intergenic
1088197953 11:107296271-107296293 AGACAGATCAATGAGACAGAAGG + Intergenic
1088204373 11:107375201-107375223 AGACAGATCAACGAGACAGAAGG + Intronic
1088352266 11:108903254-108903276 AGACAGATCATGGAGACAGAAGG - Intronic
1088371827 11:109098202-109098224 AAGCTGAACAAGAAAACAGGAGG - Intergenic
1088625143 11:111724575-111724597 AGGCAAATCAAGAAGACATCAGG + Exonic
1088721032 11:112591895-112591917 AGGCTGATGCAGCAGAGAGAGGG - Intergenic
1089248534 11:117139873-117139895 AAACAGATCAACAAGACAGAAGG + Intergenic
1090315254 11:125781152-125781174 AGACAGATCAATGAGACAGAAGG - Intergenic
1090378464 11:126308301-126308323 AGGGCAAACAAGAAGACAGAAGG - Intronic
1090648303 11:128784268-128784290 CGGCTGAACAATAAGACAGCAGG - Intronic
1090659097 11:128869314-128869336 GGGCTGAGGAGGAAGACAGAAGG - Intergenic
1090723224 11:129496064-129496086 AGACAGATCAACGAGACAGAAGG + Intergenic
1090932955 11:131315110-131315132 AGACAGATCAATGAGACAGAAGG + Intergenic
1091195866 11:133730352-133730374 AGGGTGATCCGGAAGGCAGATGG + Intergenic
1091495211 12:966423-966445 AGGATGGTCAAGCAGAAAGATGG + Intronic
1092392022 12:8088988-8089010 AGGAAGATTAAGAAGACAGTGGG - Intronic
1092453221 12:8622836-8622858 ACGCTGAGCAGGAAGAAAGAGGG - Intergenic
1092532683 12:9358554-9358576 AGACAGATCAATGAGACAGAAGG - Intergenic
1093649326 12:21625125-21625147 AGACAGATCAACGAGACAGAAGG - Intergenic
1093900203 12:24623378-24623400 AGACAGATCAATGAGACAGAAGG - Intergenic
1093998060 12:25664004-25664026 AGACAGATCAATGAGACAGAAGG - Intergenic
1094127893 12:27042607-27042629 AGACAGATCAAGGAGACAGAAGG + Intronic
1094482092 12:30892595-30892617 AGACAGATCAACGAGACAGAAGG - Intergenic
1095106813 12:38243851-38243873 TGACTGATACAGAAGACAGAAGG - Intergenic
1095151604 12:38802088-38802110 AGACAGATCAACGAGACAGAAGG + Intronic
1095186856 12:39210312-39210334 AGACAGATCAATGAGACAGAAGG + Intergenic
1095228182 12:39701519-39701541 AGACAGATCAATGAGACAGAAGG + Intronic
1095306085 12:40640743-40640765 AGACAGATCAACAAGACAGAAGG - Intergenic
1095348567 12:41182267-41182289 ATCCTGATCAATGAGACAGAAGG + Intergenic
1095442534 12:42252457-42252479 AGACAGATCAATGAGACAGAAGG - Intronic
1095527101 12:43140230-43140252 AGGCGGATCATGAGGTCAGATGG + Intergenic
1095769527 12:45937578-45937600 AGGGTGATCAAGCAGACATCTGG + Intronic
1095793556 12:46193492-46193514 AGACAGATCAACGAGACAGAAGG - Intronic
1095798669 12:46248601-46248623 AGACAGATCAACGAGACAGAAGG + Intronic
1095845500 12:46739551-46739573 AGACAGATCAACAAGACAGAAGG + Intergenic
1096359889 12:50975070-50975092 AGACAGATCAATGAGACAGAAGG + Intergenic
1096820015 12:54226521-54226543 AGGCTGATGAATGAGACAAAAGG + Intergenic
1096950345 12:55461891-55461913 AGACAGATCAATGAGACAGAAGG + Intergenic
1097139716 12:56890481-56890503 AGACAGATCAACGAGACAGAAGG + Intergenic
1097148758 12:56960827-56960849 AGACAGATCAATGAGACAGAAGG + Intergenic
1097365482 12:58707886-58707908 AGACAGATCAATGAGACAGAAGG - Intronic
1097794486 12:63846878-63846900 AGGCAAATCAAGAAGAGAGTGGG + Intronic
1097912053 12:64981334-64981356 AGACAGATCAACGAGACAGAAGG - Intergenic
1098473251 12:70869691-70869713 TGGCTGATGAAGAGGTCAGATGG + Intronic
1098540000 12:71644200-71644222 AAGCTGAAGAAGAAGAGAGAAGG - Exonic
1098752114 12:74307057-74307079 AGTTTGATCAAAAATACAGATGG + Intergenic
1099062729 12:77932220-77932242 AGGGTTATCAGGAAGACAAAAGG - Intronic
1099313710 12:81059804-81059826 AGACAGATCAACGAGACAGAAGG - Intronic
1099314513 12:81067157-81067179 AAACAGATCAACAAGACAGAAGG + Intronic
1099428043 12:82548732-82548754 AGACAGATCAACGAGACAGAAGG - Intergenic
1099740604 12:86629333-86629355 AGACAGATCAATGAGACAGAAGG + Intronic
1099820235 12:87699832-87699854 AGACAGATCAACAAGACAGAAGG - Intergenic
1099839280 12:87945460-87945482 AGACAGATCAACAAGACAGAAGG + Intergenic
1100417387 12:94392070-94392092 AGACAGATCAACGAGACAGAAGG + Intronic
1100748893 12:97675167-97675189 AGACAGATCAACGAGACAGAAGG + Intergenic
1100808532 12:98313330-98313352 AGACAGATCAACAAGACAGAAGG + Intergenic
1101346390 12:103890141-103890163 CGGCTGATCATAAAGCCAGAAGG - Intergenic
1101561084 12:105858868-105858890 AGGCTAATTTAGAAGGCAGAGGG + Intergenic
1102173042 12:110856507-110856529 AGGCTGGTTGAGAAGACAGGAGG + Intronic
1102215530 12:111158958-111158980 AGGCTGGTCGTGAACACAGAGGG + Intronic
1102290199 12:111692952-111692974 AGGGTGATCGGGAAGGCAGAGGG + Intronic
1103032315 12:117626766-117626788 AGGCAGATCAATGAGACAGAAGG - Intronic
1103032667 12:117629983-117630005 AGGCTGAACAACAAAGCAGATGG - Intronic
1103201635 12:119092735-119092757 AGGCTCAGCAAGATGCCAGAGGG + Intronic
1103260080 12:119579301-119579323 AGGCTGATCACGAGGTCAGGAGG - Intergenic
1104175133 12:126324209-126324231 AGACAGATCAACGAGACAGAAGG - Intergenic
1104539065 12:129645465-129645487 AGACTGATCAATAAGAGAAAAGG - Intronic
1105311298 13:19214287-19214309 AGACAGATCAACGAGACAGAAGG - Intergenic
1105735108 13:23260105-23260127 AGACAGATCAATGAGACAGAAGG - Intronic
1105835610 13:24208556-24208578 ATGCAGATCAAGAAGACTGGTGG + Intronic
1106018934 13:25896594-25896616 AGACAGATCAACGAGACAGAAGG - Intronic
1106817115 13:33420534-33420556 AGACAGATCAATGAGACAGAAGG + Intergenic
1107439824 13:40415818-40415840 AGACAGATCAACGAGACAGAAGG + Intergenic
1107657947 13:42610977-42610999 AGTCAATTCAAGAAGACAGATGG - Intergenic
1108188319 13:47910541-47910563 AGACAGATCAACGAGACAGAAGG + Intergenic
1108590364 13:51907424-51907446 AGGCTGATGAAGTAGGCAGCTGG - Intergenic
1108797250 13:54046435-54046457 AGACAGATCAATGAGACAGAAGG + Intergenic
1108865749 13:54920300-54920322 AGACAGATCAATGAGACAGAAGG + Intergenic
1108989014 13:56631350-56631372 AGACAGATCAATGAGACAGAAGG + Intergenic
1109216297 13:59593204-59593226 AGACAGATCAGCAAGACAGAAGG + Intergenic
1109358794 13:61269003-61269025 AGACAGATCAATGAGACAGAAGG + Intergenic
1109492587 13:63122120-63122142 GGGCGGATCAAGAAGTCAGGAGG - Intergenic
1109574639 13:64238300-64238322 AAGCTGCTCAAGATGACAGGTGG - Intergenic
1109755757 13:66757191-66757213 AAGTTGCTCTAGAAGACAGAGGG - Intronic
1109806884 13:67454887-67454909 AGACAGATCAATGAGACAGAAGG + Intergenic
1109816464 13:67590953-67590975 AGACAGATCAATGAGACAGAAGG + Intergenic
1109964118 13:69669313-69669335 AGACATATCAACAAGACAGAAGG + Intergenic
1110378772 13:74825301-74825323 GAGCTGATCAAGCAGAGAGAGGG + Intergenic
1110687234 13:78389260-78389282 AGGCGGATTCAGAACACAGAGGG + Intergenic
1110824153 13:79952905-79952927 AGACAGATCAACAAGACAGAAGG + Intergenic
1110876761 13:80519429-80519451 AGACAGATCAATGAGACAGAAGG + Intergenic
1110904051 13:80863202-80863224 GGGCAGATCACGAAGTCAGAAGG + Intergenic
1111599038 13:90447852-90447874 AGGCTGAGTTAGAAGACAGAAGG - Intergenic
1111648390 13:91060719-91060741 AGGCTCCACAAGAAGACAGAAGG + Intergenic
1111712298 13:91832020-91832042 AGACAGATCAATGAGACAGAAGG - Intronic
1111907231 13:94269533-94269555 TAGCTGATTAAAAAGACAGAAGG - Intronic
1111932873 13:94529220-94529242 AGACAGATCAATGAGACAGAAGG + Intergenic
1112243329 13:97703832-97703854 AACCTGATAAAGAAGACAAAGGG - Intergenic
1112248174 13:97753479-97753501 ATGCTGATAAGGAAGACAGGAGG - Intergenic
1112352058 13:98644003-98644025 AGCCTGATCAAGCAGACAAAAGG - Intergenic
1113348546 13:109505842-109505864 AGGCAGATCAACGAGACAGAAGG - Intergenic
1113390408 13:109890972-109890994 TGGATGATGAAGAAGACAGATGG + Intergenic
1113900892 13:113797327-113797349 CTGCTGAGGAAGAAGACAGATGG + Intronic
1113921036 13:113910557-113910579 AGACTGACCAAAAAGAGAGAAGG - Intergenic
1114142623 14:19932385-19932407 AGGGTGCTCAAGAAGACAAAGGG - Intergenic
1114572974 14:23687871-23687893 AGCCAGATCAACGAGACAGAAGG - Intergenic
1114981520 14:28170539-28170561 AGACAGATCAATGAGACAGAAGG + Intergenic
1115018224 14:28642510-28642532 AGACAGATCAATGAGACAGAAGG - Intergenic
1115184182 14:30665995-30666017 AGACAGATCAACGAGACAGAAGG + Intronic
1115192925 14:30766119-30766141 AGACTGTTCAAGAACAAAGAAGG + Intergenic
1115294418 14:31810178-31810200 AGACAGATCAACAAGACATAAGG - Intronic
1115774149 14:36697471-36697493 AGACAGATCAACGAGACAGAAGG - Intronic
1115832803 14:37361389-37361411 AGACTGATCAATGAGAGAGAAGG - Intronic
1115947023 14:38673509-38673531 AGACAGATCAATGAGACAGAAGG + Intergenic
1116052618 14:39823582-39823604 AGACAGATCAACGAGACAGAAGG - Intergenic
1116165329 14:41327924-41327946 AGACAGATCAATGAGACAGAAGG - Intergenic
1116212495 14:41966375-41966397 AGACAGATCAATGAGACAGAAGG - Intergenic
1116249036 14:42457405-42457427 TGGCTTATACAGAAGACAGATGG + Intergenic
1116457900 14:45140428-45140450 ATGCTGATCAAGAACACAGTAGG - Intronic
1116483012 14:45413989-45414011 AGACAGATCAATGAGACAGAAGG + Intergenic
1116618240 14:47165358-47165380 AGCCTGAACTAGAAGACAGCTGG - Intronic
1116669977 14:47828742-47828764 AGCCTGTGCAAGCAGACAGAGGG - Intergenic
1117005426 14:51416714-51416736 AGACAGATCAACAAGACAGAAGG - Intergenic
1117123435 14:52594385-52594407 AGCCAGATCAACGAGACAGAAGG - Intronic
1117720299 14:58622885-58622907 AGCCTGCTCAAGACCACAGAGGG + Intergenic
1117729296 14:58705449-58705471 TGGCTGAGCAAAAAGACAGAAGG - Intergenic
1117822595 14:59666021-59666043 AGACAGATCAACCAGACAGAAGG + Intronic
1118829724 14:69419562-69419584 AGACAGATCAACAAGACAGAAGG - Intronic
1119093627 14:71808111-71808133 AGACAGATCAATGAGACAGAAGG + Intergenic
1119334352 14:73820087-73820109 AGCCTGATAAAAATGACAGATGG - Intergenic
1119752972 14:77093564-77093586 AGTATCAGCAAGAAGACAGAGGG + Intergenic
1120066004 14:80041398-80041420 AGACAGATCAATGAGACAGAAGG + Intergenic
1120572261 14:86135024-86135046 AGGCGGATCACGAAGTCAGGAGG - Intergenic
1120584530 14:86295422-86295444 AAGCTGAGCAAGAAGACAGGAGG - Intergenic
1122068437 14:99189736-99189758 AGGCTGATGACAAAGCCAGAGGG + Intronic
1122443111 14:101747757-101747779 AGACAGATCAATGAGACAGAAGG - Intergenic
1124217774 15:27823308-27823330 ATGCTAATGAAGAAGAAAGAGGG + Intronic
1124628143 15:31321690-31321712 TGGCTGATCAAGCAGGCAGTGGG + Intergenic
1124782127 15:32646039-32646061 AGGCGGATCATGAGGTCAGATGG - Intronic
1125351933 15:38777146-38777168 AGACAGATCAATGAGACAGAAGG - Intergenic
1125584367 15:40809810-40809832 AGGCTCTTGAAGAAGGCAGAGGG - Intronic
1125653277 15:41334679-41334701 AGGCAGATAAAGGAGAAAGAAGG - Intronic
1126071502 15:44868709-44868731 AGACAGATCAACAAGACAGAAGG + Intergenic
1126074265 15:44894089-44894111 AGACAGATCAATGAGACAGAAGG - Intergenic
1126083929 15:44992703-44992725 AGACAGATCAACGAGACAGAAGG + Intergenic
1126177949 15:45756067-45756089 AGACAGATCAACAAGACAGAAGG - Intergenic
1126722250 15:51593495-51593517 AGACAGATCAACGAGACAGAAGG + Intronic
1127021337 15:54751833-54751855 AGACAGATCAACGAGACAGAAGG + Intergenic
1127038501 15:54946641-54946663 AGACAGATCAATGAGACAGAAGG + Intergenic
1127168214 15:56270207-56270229 AGGCAGATCAATGAGACAGAAGG - Intronic
1127427095 15:58867376-58867398 AGGCTGCATAAGAAGGCAGAGGG - Intronic
1128696827 15:69771637-69771659 AGACAGATCAATGAGACAGAAGG + Intergenic
1129578739 15:76782461-76782483 AGACAGATCAATGAGACAGAAGG + Intronic
1130167190 15:81473510-81473532 AGGCTGATCAAAATCACAGATGG + Intergenic
1130176995 15:81583424-81583446 AGACAGATCAATGAGACAGAAGG + Intergenic
1130452859 15:84074661-84074683 AGACAGATCAACAAGACAGAAGG + Intergenic
1130697980 15:86149707-86149729 AGACAGATCAATGAGACAGAAGG + Intronic
1130703428 15:86209377-86209399 AGACAGATCAACGAGACAGAAGG - Intronic
1130800695 15:87260317-87260339 AGACAGATCAATGAGACAGAAGG - Intergenic
1130955136 15:88622075-88622097 TGGCTGATCAAGAGGGCAGAGGG - Intronic
1132258913 15:100403505-100403527 AGACTGATAAAGAAAAAAGAGGG + Intronic
1133968462 16:10548940-10548962 AGGCTGATGAAGAGGGCAGCAGG + Intronic
1135061733 16:19276861-19276883 TGGCTGGTGCAGAAGACAGATGG - Intergenic
1135220503 16:20610900-20610922 AGGCTAGTCAAGAAGCCAGCTGG + Intronic
1135221020 16:20614025-20614047 AGGCTGAGCAAGAAGCCGGCAGG + Intronic
1135301532 16:21332583-21332605 AGACAGATTAACAAGACAGAAGG - Intergenic
1135512313 16:23096422-23096444 AGACAGATCAACAAGACAAAAGG + Intronic
1135865257 16:26095196-26095218 AGACAGATCAATGAGACAGAAGG + Intronic
1135897564 16:26421817-26421839 AGACAGATCAATGAGACAGAAGG + Intergenic
1136135778 16:28256135-28256157 AGACTGAGCAAGAGGACAGCTGG - Intergenic
1136731224 16:32415346-32415368 AGAAAGATCAACAAGACAGAAGG - Intergenic
1137324742 16:47422985-47423007 AGACAGATCAACAAGACAGAAGG - Intronic
1137335466 16:47544649-47544671 AGACAGATCAACAAGACAGAAGG - Intronic
1137371698 16:47912427-47912449 AGACAGATCAATGAGACAGAAGG + Intergenic
1137471318 16:48761291-48761313 AGACAGATCAATGAGACAGAAGG + Intergenic
1137478290 16:48829791-48829813 AGGATGACCAAGAAGAAATATGG - Intergenic
1137525350 16:49230652-49230674 AGACAGATCAACGAGACAGAAGG + Intergenic
1138174190 16:54881777-54881799 AGGCTTATAAAGAAAAGAGAAGG - Intergenic
1138783070 16:59811884-59811906 AGACAGATCAATGAGACAGAAGG + Intergenic
1138890326 16:61135374-61135396 AGGCTGAAAAAGAGGAGAGAGGG + Intergenic
1139392438 16:66613323-66613345 TGACTGGTCCAGAAGACAGAGGG + Exonic
1140147662 16:72326964-72326986 AGACAGATCAATGAGACAGAAGG + Intergenic
1141222292 16:82082247-82082269 AGGCTGGACAAGCAGATAGAAGG - Intronic
1202995167 16_KI270728v1_random:101927-101949 AGAAAGATCAACAAGACAGAAGG + Intergenic
1203021854 16_KI270728v1_random:414269-414291 AGAAAGATCAACAAGACAGAAGG + Intergenic
1142839476 17:2615908-2615930 AGACTGAGAAAGAAGACACAAGG + Intronic
1142936752 17:3340826-3340848 AGACAGATCAACAAGACAGAAGG - Intergenic
1144294271 17:13858061-13858083 AGACAGATCAATGAGACAGATGG + Intergenic
1144907604 17:18648946-18648968 GGGCTGATCACGAGGTCAGATGG + Intronic
1145396533 17:22500514-22500536 AGACAGATCAATGAGACAGAAGG - Intergenic
1145738575 17:27251779-27251801 AGACAGACCAACAAGACAGAAGG + Intergenic
1146013781 17:29216552-29216574 ATGATGATGAACAAGACAGATGG - Intergenic
1146092709 17:29897708-29897730 AGACAGATCAATGAGACAGAAGG + Intronic
1146145255 17:30410418-30410440 AGACAGATCAATGAGACAGAAGG - Intronic
1148671692 17:49415242-49415264 TGGCTGATGAAGAGGACAGGTGG + Intronic
1149193213 17:54088197-54088219 AGACAGATCAACAAGACAGGAGG + Intergenic
1149225272 17:54463455-54463477 AGACAGATCAGCAAGACAGAAGG - Intergenic
1149240386 17:54641777-54641799 AGACAGATCAATGAGACAGAAGG + Intergenic
1149255653 17:54823242-54823264 AGACAGATCAATGAGACAGAAGG + Intergenic
1149329378 17:55565744-55565766 AAGCTGGTGAAGAAGAGAGATGG + Intergenic
1149357469 17:55856711-55856733 AAGCTGATCAAAAACAGAGAAGG - Intergenic
1149886293 17:60343232-60343254 AGACAGATCAACGAGACAGAAGG + Intronic
1149901713 17:60486258-60486280 AGACAGATCAATGAGACAGAAGG - Intronic
1149931818 17:60764757-60764779 AGACAGATCAATGAGACAGAAGG - Intronic
1150026087 17:61675597-61675619 AGACAGATCAACAAGACAGAAGG + Intergenic
1150094358 17:62359543-62359565 AGACAGATCAACGAGACAGAAGG + Intergenic
1150201104 17:63358790-63358812 AGGCTGATAGAGTAGACAGTCGG + Intronic
1152250061 17:79207827-79207849 AGGATGAGCAAGAAGAGAGAAGG - Intronic
1152498051 17:80688421-80688443 AGGTTTATCAAGAAGTCTGAAGG + Intronic
1152555591 17:81051616-81051638 AGGCGGATCACGAGGTCAGATGG - Intronic
1153441509 18:5124567-5124589 AGACAGATCAACAAGACAGAAGG + Intergenic
1154184474 18:12170691-12170713 AGACAGATCAACGAGACAGAAGG - Intergenic
1154389351 18:13923224-13923246 AGGCTGAAGAAGCAGAAAGAGGG - Intergenic
1155159430 18:23183701-23183723 AGGCTGACCAAGTAGACATATGG - Intronic
1155178970 18:23326632-23326654 AAACAGATCAACAAGACAGAAGG + Intronic
1156470772 18:37376140-37376162 GGGCTGGTCAGGAAGAAAGAAGG - Intronic
1156659228 18:39326923-39326945 AGGCAGAACCAAAAGACAGAGGG + Intergenic
1156736667 18:40268155-40268177 GGGCTGATCACTAAGGCAGAAGG - Intergenic
1156854160 18:41762833-41762855 AGATCGATCAAGAAGACAGCTGG + Intergenic
1156908118 18:42379331-42379353 AGACAGATCAACAAGGCAGAAGG - Intergenic
1157025540 18:43838054-43838076 AGACAGATCAATGAGACAGAAGG + Intergenic
1157561700 18:48651546-48651568 AGACAGATCAACGAGACAGAAGG + Intronic
1157787706 18:50500638-50500660 AGACAGATCAATGAGACAGAAGG - Intergenic
1158145475 18:54307645-54307667 AGACAGATCAACGAGACAGAAGG - Intronic
1158674620 18:59506985-59507007 AGGCTGAGCATGGAGACAGAAGG - Intronic
1158792647 18:60800514-60800536 AGACAGATCAATGAGACAGAAGG - Intergenic
1160260421 18:77288908-77288930 AGACAGATCAACGAGACAGAAGG - Intergenic
1160296234 18:77639676-77639698 AGAAAGATCAACAAGACAGAAGG + Intergenic
1161264069 19:3355426-3355448 AGGCGGATCATGAGGTCAGAAGG - Intergenic
1161658930 19:5534004-5534026 AGGCAGAGCAACAAGACCGAAGG + Intergenic
1161714779 19:5869203-5869225 AGGCGGATCACGAGGTCAGATGG - Intronic
1162497530 19:11031728-11031750 AGGCTGATCAACAGAAAAGACGG - Intronic
1163494159 19:17635090-17635112 AGGCGGATCATGAGGTCAGATGG - Intronic
1163680143 19:18676482-18676504 GGTCTGATCATGAAGAGAGAGGG - Intergenic
1163940241 19:20485013-20485035 AGACAGATCAATGAGACAGAAGG + Intergenic
1163976161 19:20854633-20854655 AGACAGATCAATGAGACAGAAGG + Intronic
1164395039 19:27855247-27855269 AGACACATCAAGGAGACAGAAGG + Intergenic
1164406003 19:27947238-27947260 AGACAGATCAACAAGACAGAAGG - Intergenic
1164556068 19:29253189-29253211 AGACAGATCAATGAGACAGAAGG - Intergenic
1165400389 19:35596027-35596049 AGACAGAGCAAGAAGAAAGAAGG + Intergenic
1166163458 19:40969042-40969064 AGACAGATCATCAAGACAGAAGG - Intergenic
1166988595 19:46677465-46677487 AGGGAGCTCAGGAAGACAGATGG - Intronic
1167388267 19:49177550-49177572 AGGCAGATCACGAGGTCAGAAGG - Intronic
1168306551 19:55439030-55439052 AGGCTGATCATGGAGATGGATGG - Intronic
1168604937 19:57751080-57751102 GGGCTGCTCAAGGAGAGAGAGGG - Intronic
925423823 2:3732597-3732619 AGGCTGATCAAGGAGTTTGAGGG + Intronic
925563012 2:5218676-5218698 AGCCTGATGGAGAAGACAGCTGG - Intergenic
925672927 2:6331044-6331066 AGGCAGATCAACGAGACAGAAGG - Intergenic
925828569 2:7874468-7874490 AGGCTGAGGAACAAGAAAGAAGG + Intergenic
926046013 2:9710109-9710131 TGGCAGAGCAATAAGACAGAAGG + Intergenic
926672708 2:15590999-15591021 AGGCGGATCACGAAGTCAGGAGG - Intergenic
927028180 2:19091840-19091862 AGACAGATCAACAAGACAGAAGG + Intergenic
927119429 2:19941616-19941638 AGGCTGAACAATAAGAGAGCAGG + Intronic
927286333 2:21360701-21360723 TGGCTGGTGTAGAAGACAGATGG + Intergenic
927470113 2:23368484-23368506 AGACTGATCAAGAAAAAAGAAGG + Intergenic
927564337 2:24097713-24097735 AGACAGATCAACGAGACAGAAGG + Intronic
927610524 2:24535010-24535032 AGACAGATCAATAAGACAGAAGG - Intronic
928900536 2:36313396-36313418 AGACAGATCAATGAGACAGAAGG - Intergenic
929358769 2:41057672-41057694 AGACAGATCAACAAGACAGAAGG + Intergenic
929860715 2:45675093-45675115 TGGCTGACCAGGAAGACAGCAGG + Intronic
930839953 2:55835085-55835107 AGACAGATCAATGAGACAGAAGG - Intergenic
930908670 2:56604388-56604410 AGACAGATCAACAAGACAGAAGG - Intergenic
931040554 2:58293853-58293875 AGTCTAATCATGTAGACAGAGGG - Intergenic
931129411 2:59317100-59317122 AGTCTCATAAACAAGACAGAAGG + Intergenic
931204409 2:60133756-60133778 AGGCAGATCAATGAGACAGAAGG - Intergenic
931885512 2:66613177-66613199 AGACAGATCAACGAGACAGATGG - Intergenic
931971487 2:67591488-67591510 AGACAGATCAACGAGACAGAAGG + Intergenic
931985937 2:67742519-67742541 AGACAGATCAACAAGACAGAAGG - Intergenic
932324168 2:70844757-70844779 AGACAGATCAACAAGACAGAAGG + Intergenic
932868463 2:75372445-75372467 AGACAGATCAATGAGACAGAAGG - Intergenic
933366480 2:81360520-81360542 AGACAGATCAACAGGACAGAAGG - Intergenic
934314483 2:91903913-91903935 AGAAAGATCAACAAGACAGAAGG + Intergenic
934318754 2:91951654-91951676 AGACAGATCAATGAGACAGAAGG + Intergenic
934617308 2:95781033-95781055 AGGCAGATCAATGAGACAGAAGG + Intergenic
934643585 2:96043526-96043548 AGGCAGATCAATGAGACAGAAGG - Intergenic
934836993 2:97599595-97599617 AGGCAGATCAATGAGACAGAAGG - Intergenic
935062739 2:99622434-99622456 AGGCTGAGCAAAGAGAGAGAAGG + Intronic
935566199 2:104609884-104609906 AGACAGATCAACAAGACAGAAGG + Intergenic
936010343 2:108921439-108921461 AGGTAAATCAAGAAAACAGAGGG + Intronic
936142882 2:109955528-109955550 AGACAGATCAACGAGACAGAAGG + Intergenic
936179569 2:110253493-110253515 AGACAGATCAACGAGACAGAAGG + Intergenic
936201806 2:110415939-110415961 AGACAGATCAACGAGACAGAAGG - Intronic
936530816 2:113276212-113276234 AAGCTGATCAGAAAGACAGACGG + Intronic
936649628 2:114411542-114411564 AGACAGATCAACGAGACAGAAGG - Intergenic
937095901 2:119235012-119235034 TGGCTGAGCAAGAATCCAGATGG - Intronic
937785311 2:125888618-125888640 TGGCTCATGCAGAAGACAGACGG - Intergenic
937952250 2:127397680-127397702 AGGCTGATCTTGGAGGCAGAGGG - Intergenic
938110635 2:128562657-128562679 AGGCTGATAAGGAAGGCAAAGGG + Intergenic
938559196 2:132456040-132456062 AGACAGATCAATGAGACAGAAGG - Intronic
938862098 2:135380243-135380265 AGACAGATCAGCAAGACAGAAGG + Intronic
939019694 2:136944443-136944465 AGACAGATCAAGGAGACAGAAGG - Intronic
939166219 2:138643791-138643813 AGGCTGCAAAAGTAGACAGAAGG - Intergenic
939434582 2:142157669-142157691 AAAATGATCAAGAACACAGAAGG + Intergenic
939566078 2:143788090-143788112 AAAATGATCAAGAAGACACATGG + Intergenic
939661395 2:144895090-144895112 AAGGTGATCAGGAAGAGAGAGGG - Intergenic
939753298 2:146075844-146075866 AGACAGATCAACAAGACAGAAGG + Intergenic
939795965 2:146644396-146644418 AGACAGATCAAAGAGACAGAAGG + Intergenic
939975035 2:148707428-148707450 AGACAAATCAACAAGACAGAAGG + Intronic
940257456 2:151745910-151745932 AGACAGATCAACGAGACAGAAGG + Intergenic
940528013 2:154842501-154842523 AGACAGATCAACTAGACAGAAGG - Intronic
940703027 2:157070188-157070210 AGACAGATCAACGAGACAGAAGG + Intergenic
940720512 2:157277381-157277403 AGACAGATCAATGAGACAGAAGG - Intronic
942056694 2:172190829-172190851 AGACAGATCAACAAGACAGAAGG - Intergenic
942116129 2:172731060-172731082 ATCCTGCTCAAGAAGACAGCTGG + Intergenic
942130947 2:172878612-172878634 AGGCAGGTAAAGTAGACAGATGG + Intronic
942392115 2:175506042-175506064 AGACAGATCAACAAGACAGAAGG + Intergenic
942434876 2:175960139-175960161 AGACAGATCAACGAGACAGAAGG + Intronic
942474901 2:176309453-176309475 AGACAGATCAACAAGACAGCAGG - Intronic
942669132 2:178354667-178354689 AGACAGATCAAAGAGACAGAAGG + Intronic
942780154 2:179632131-179632153 AGACAGATCAATGAGACAGAAGG + Intronic
943987499 2:194641357-194641379 AGACAGATCAAGGAGACAGAAGG + Intergenic
944343837 2:198636569-198636591 ACACTGAACAAGAAGACAGAAGG + Intergenic
944476998 2:200117067-200117089 AGACAGATCAATGAGACAGAAGG - Intergenic
944569244 2:201026394-201026416 AGACAGATCAATGAGACAGAAGG + Intronic
945563039 2:211362029-211362051 AGGAAGATCAAAAAGAAAGAAGG - Intergenic
945597164 2:211810251-211810273 AGACAGATCAACAAGACAGAAGG - Intronic
945715859 2:213357317-213357339 AGACAGATCAACGAGACAGAAGG - Intronic
945776452 2:214112372-214112394 AGACAGATCAATGAGACAGAAGG - Intronic
946812624 2:223542243-223542265 TGGCTTATCATGAAGACCGAAGG - Intergenic
947093948 2:226544980-226545002 AGGCCAATCAAGCAGAAAGATGG - Intergenic
947301663 2:228694829-228694851 AGACAGATCAACAAGACAGAAGG - Intergenic
947625474 2:231615601-231615623 AAGCTGATCAAGAGGACACCTGG - Intergenic
948829580 2:240591789-240591811 AGGATGAGGAAGAAGGCAGAGGG + Intronic
1169013064 20:2267041-2267063 AGACAGATCAATGAGACAGAAGG + Intergenic
1169306854 20:4499365-4499387 AGATAGATCAACAAGACAGAAGG - Intergenic
1169796074 20:9463860-9463882 AGACAGATCAATGAGACAGAAGG + Intronic
1169861920 20:10161647-10161669 AGACAGATCAATGAGACAGAAGG + Intergenic
1170186409 20:13595806-13595828 AGACAGATCAACAAGACAGAAGG + Intronic
1170483389 20:16791393-16791415 AGACAGATCAACAAGACAGAAGG - Intergenic
1170543630 20:17413613-17413635 AGACAGATCAACGAGACAGAAGG + Intronic
1171039675 20:21749233-21749255 AGGCAGATCAATGAGACAGAAGG - Intergenic
1171194062 20:23183454-23183476 AGACAGATCAACGAGACAGAAGG - Intergenic
1171337688 20:24400056-24400078 AGACAGATCAACAAGACACAAGG - Intergenic
1171443286 20:25184391-25184413 AGACAGATTAACAAGACAGAAGG - Intergenic
1173022786 20:39282256-39282278 TGGCTGATCTAGATGAAAGAAGG + Intergenic
1173779380 20:45741905-45741927 TGCCTGAGCAAGAAGATAGATGG + Intergenic
1173821902 20:46025032-46025054 AGCCTGAGCTAGAACACAGATGG - Intronic
1173919179 20:46731190-46731212 TGGCAGAGCAACAAGACAGAAGG - Intronic
1174223829 20:48980543-48980565 AGACAGATCAACAAGACAGAAGG - Intronic
1174451342 20:50622591-50622613 TGGCTGAACAACAAGAGAGAAGG + Intronic
1176928689 21:14781492-14781514 AGACAGATCAACAAGACAGAAGG + Intergenic
1177111719 21:17036676-17036698 AGACAGATCAATGAGACAGAAGG + Intergenic
1177661400 21:24088027-24088049 AGACAGGTCATGAAGACAGAAGG + Intergenic
1178149074 21:29773522-29773544 AGTGTGATAAAGAAGGCAGAAGG - Intronic
1178975569 21:37218292-37218314 AGGCTGAGCATGAAGACTTAGGG - Intergenic
1179132162 21:38647565-38647587 AGGTTGATCATGAAAACAGGAGG + Intronic
1180029719 21:45198269-45198291 AGGCTGATCAAGAAGACAGAAGG + Intronic
1180306929 22:11135319-11135341 AGACAGATCAATGAGACAGAAGG + Intergenic
1180545449 22:16497502-16497524 AGACAGATCAATGAGACAGAAGG + Intergenic
1180640749 22:17297173-17297195 AGACAGATCAACAAGACAGAAGG - Intergenic
1180724255 22:17933051-17933073 AGACAGATCAACGAGACAGAAGG + Intronic
1181025705 22:20126130-20126152 AGTCAGATGAAGGAGACAGAAGG + Intronic
1181326662 22:22054830-22054852 AGACAGATCAATGAGACAGAAGG - Intergenic
1181445475 22:22969601-22969623 AGACAGATCAATGAGACAGAAGG + Intergenic
1182058001 22:27375603-27375625 AGACAGATCAACGAGACAGAAGG + Intergenic
1182152229 22:28036071-28036093 AGACAGATCAACGAGACAGAAGG + Intronic
1182502029 22:30754807-30754829 AAGCTGATCCAGAAGCCAGGGGG - Intronic
1183307646 22:37091373-37091395 AGGCTGACCAAGCTGACAGGGGG - Intronic
949245021 3:1917050-1917072 AGACAGATCAACAAGAAAGAAGG - Intergenic
949427897 3:3939424-3939446 AGACAGATCAACAAGACAGAAGG - Intronic
949579624 3:5374878-5374900 AGACAGATCAATGAGACAGAAGG - Intergenic
949800259 3:7896376-7896398 AGACAGATCAATGAGACAGAAGG - Intergenic
949870425 3:8583481-8583503 AGCCTGATAAAGGAGGCAGATGG - Intergenic
949963885 3:9338617-9338639 AGGCTTATCAAGAAGACCTGAGG - Intronic
950057302 3:10036267-10036289 AGGCTAAAAAAGAAGACATAGGG - Exonic
951012407 3:17695678-17695700 AGACAGATCAACAAGACAGAAGG + Intronic
951389458 3:22084659-22084681 AGACAGATCAATGAGACAGAAGG + Intronic
951747560 3:25996678-25996700 AGACAGATCAATGAGACAGAAGG - Intergenic
951759316 3:26128060-26128082 AGACAGATCAATGAGACAGAAGG - Intergenic
951985961 3:28621166-28621188 AGACAGATCAATGAGACAGAAGG + Intergenic
952006218 3:28845250-28845272 AGGAGGAACAAGAAGAAAGAGGG - Intergenic
952402623 3:32976838-32976860 AGGATGATCAAGAAAATGGATGG + Intergenic
952513773 3:34083272-34083294 AGACAGATCAATGAGACAGAAGG - Intergenic
952550328 3:34469861-34469883 AGACAGATCAATGAGACAGAAGG - Intergenic
952813751 3:37428915-37428937 AGACAGATCAACGAGACAGAAGG - Intronic
953218823 3:40948828-40948850 AGACAAATCAACAAGACAGAAGG - Intergenic
953254902 3:41280239-41280261 AGACAGATCAACGAGACAGAAGG + Intronic
953319054 3:41955657-41955679 AGGTTCATCAAGAAGAGAGTGGG + Intronic
953936653 3:47050337-47050359 AGGATCATCAAGATGTCAGAAGG + Intronic
954513604 3:51150898-51150920 AGACAGATCAACGAGACAGAAGG - Intronic
954513665 3:51151487-51151509 AGACAGATCAATGAGACAGAAGG + Intronic
954572175 3:51650366-51650388 AGACAGATCAACGAGACAGAAGG + Intronic
954828183 3:53393716-53393738 AGACAGATCAATGAGACAGAAGG + Intergenic
954833499 3:53444300-53444322 AGACAGATCAATGAGACAGAAGG - Intergenic
954836250 3:53471500-53471522 AGACAGATCAATGAGACAGAAGG - Intergenic
955361418 3:58279162-58279184 AGACAGATCAATGAGACAGAAGG - Intronic
956477166 3:69634915-69634937 AGACAGATCAATGAGACAGAAGG - Intergenic
956608699 3:71099890-71099912 GAGCTGATCAAGAAGAGACATGG + Intronic
956993529 3:74796788-74796810 AGATAGATCAACAAGACAGAAGG + Intergenic
957353029 3:79050478-79050500 AGACAGATCAATGAGACAGAAGG + Intronic
957886072 3:86289465-86289487 AGCCTGTTCAAAAAGACAAAAGG - Intergenic
958030013 3:88097412-88097434 AGACAGATCAATGAGACAGAAGG + Intronic
958037227 3:88184521-88184543 AGACAGATCAATGAGACAGAAGG + Intergenic
958191526 3:90191210-90191232 AGACAGATCAACAAGACAGAAGG - Intergenic
958413728 3:93850307-93850329 AGACAGATCAACGAGACAGAAGG - Intergenic
958448200 3:94240696-94240718 AGACAGATCAACGAGACAGAAGG - Intergenic
958742661 3:98093959-98093981 AGACAGATCAATGAGACAGAAGG - Intergenic
958801024 3:98756044-98756066 AAGCTGGAAAAGAAGACAGATGG + Intronic
958849175 3:99303088-99303110 AGACAGATCAATGAGACAGAAGG + Intergenic
958873728 3:99591451-99591473 AGACAGATCAACGAGACAGACGG + Intergenic
958999339 3:100943796-100943818 AGGCTGATTATGAAGACAACTGG - Intronic
959004649 3:101006727-101006749 AGACAGATCAATGAGACAGAAGG - Intergenic
959041850 3:101431241-101431263 AGACAGATCAATGAGACAGAAGG - Intronic
959308037 3:104694532-104694554 AGACAGATCAACGAGACAGAAGG - Intergenic
959723721 3:109521020-109521042 AGACAGATCAATGAGACAGAAGG - Intergenic
959763760 3:109999949-109999971 AGACAGATCAGCAAGACAGAAGG - Intergenic
959939908 3:112070390-112070412 AGACAGATCAACAAGACAGAAGG - Intronic
960209033 3:114937645-114937667 AGGCTGATCACGAGGTCAGGAGG - Intronic
960276507 3:115735708-115735730 AGACAGATCAATGAGACAGAAGG - Intergenic
960508331 3:118519327-118519349 AGACAGATCAATGAGACAGAGGG + Intergenic
960734384 3:120762275-120762297 AGACAGATCAACGAGACAGAAGG - Intronic
960751931 3:120964832-120964854 AGACAGATCAATGAGACAGAAGG - Intronic
960784185 3:121354242-121354264 AGGCAGATCAATGAGACAGAAGG - Intronic
960832127 3:121861231-121861253 AGACAGATCAATGAGACAGAAGG - Intronic
960890850 3:122446102-122446124 AGACAGATCAACACGACAGAAGG + Intronic
960911495 3:122653610-122653632 AGACAGATCAACGAGACAGAAGG + Intergenic
961584163 3:127908509-127908531 AGGTGGAACAAGAAGAGAGAAGG + Intergenic
962136884 3:132744712-132744734 AGACAGATCAATGAGACAGAAGG - Intergenic
962163418 3:133023609-133023631 ATGCAGATCAGGAAGGCAGAAGG + Intergenic
962178139 3:133176252-133176274 AGACAGATCAACAAGACAGAAGG + Intronic
962190929 3:133310263-133310285 AGACAGATCAACGAGACAGAAGG - Intronic
962602567 3:137005326-137005348 AGACAGATCAACGAGACAGAAGG - Intronic
962675423 3:137753277-137753299 AGACAGATCAACAAGACAGAAGG + Intergenic
962767217 3:138576532-138576554 AGACAGATCAACAAGACAGAAGG + Intronic
962861551 3:139407159-139407181 AGACAGATCAACGAGACAGAAGG + Intergenic
963048255 3:141120472-141120494 AGACAGATCAGCAAGACAGAAGG - Intronic
963191510 3:142478651-142478673 AGACAGATCAACGAGACAGAAGG - Intronic
963382637 3:144551338-144551360 AGGCTGATCTAGCAGAGAAAGGG + Intergenic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964123613 3:153212323-153212345 TGGCTGATAGAGAAGACAAATGG + Intergenic
964270263 3:154947727-154947749 AGACGGATCAACGAGACAGAAGG + Intergenic
964782995 3:160361456-160361478 AGACAGATCAACAAGACAGAAGG + Intronic
965163613 3:165167355-165167377 AGACAGATCAATAAGACAGAAGG - Intergenic
966477807 3:180369942-180369964 AGACAGATCAATGAGACAGAAGG + Intergenic
966582913 3:181588953-181588975 AGACAGATCAATGAGACAGAAGG - Intergenic
967343400 3:188426513-188426535 AGACAGATCAACGAGACAGAAGG - Intronic
968352339 3:198069074-198069096 AGGCTGAGGAAGAAGAAAAAAGG - Intergenic
968942960 4:3648680-3648702 AGGCTGATGAGAAAGACAGCGGG - Intergenic
969194353 4:5548400-5548422 AGGATGACCAAGCAGAAAGATGG + Intronic
969807437 4:9620488-9620510 AGACAGATCAATGAGACAGAAGG + Intergenic
970156037 4:13142576-13142598 AGGTTGAGGAAGCAGACAGAGGG - Intergenic
970183078 4:13419330-13419352 AGACAGATCAACGAGACAGAAGG + Intronic
970320732 4:14873115-14873137 AGCCAGATCAAGATGACAAAAGG + Intergenic
970470221 4:16370831-16370853 AGACAGATCAAGAAGACAGAAGG - Intergenic
970791770 4:19866380-19866402 AGACAGATCAATGAGACAGAAGG - Intergenic
971437489 4:26643007-26643029 AGACAGATCAATGAGACAGAAGG + Intronic
971466922 4:26973799-26973821 AGACAGATCAACAAGACAGAAGG - Intronic
971528245 4:27650520-27650542 AGCCTGAAAAAGAAGACACATGG - Intergenic
971898943 4:32633471-32633493 AGGCGGATCACGAGGTCAGAAGG + Intergenic
972178537 4:36437639-36437661 AGACAGATCAACGAGACAGAAGG - Intergenic
972196419 4:36658607-36658629 AGGCAGATCAACAAGACAGAAGG + Intergenic
972685852 4:41352035-41352057 AGACAGATCAACGAGACAGAAGG + Intergenic
972859618 4:43151501-43151523 AGACAGATCAACGAGACAGAAGG - Intergenic
973111939 4:46407253-46407275 AGACAGATCAACAAGACAAAAGG + Intronic
973122229 4:46535802-46535824 AAGCTGAGTAAGAAGAGAGAGGG - Intergenic
973557135 4:52094947-52094969 AGGCAGACACAGAAGACAGATGG - Exonic
973599251 4:52524816-52524838 AGACAGATCAATGAGACAGAAGG + Intergenic
973665787 4:53157875-53157897 AGGCTGAGAAACAAGATAGAAGG + Intronic
973875008 4:55208749-55208771 AAACAGATCAATAAGACAGAAGG + Intergenic
973883794 4:55299713-55299735 AGACAGATCAACAAGACAGAAGG + Intergenic
973921741 4:55693390-55693412 AGACAGATCAATGAGACAGAAGG + Intergenic
974044585 4:56887160-56887182 AGACAGATCAACGAGACAGAAGG + Intergenic
974177221 4:58339656-58339678 AGACAGATCAATGAGACAGAAGG + Intergenic
974567144 4:63592182-63592204 AGACAGATCAATGAGACAGAAGG + Intergenic
974979496 4:68937145-68937167 AGAAAGATCAAGGAGACAGAAGG + Intronic
975236116 4:71998628-71998650 AGGTAGATCAACAAGACAGAAGG + Intergenic
975291416 4:72681861-72681883 AGACAGATCAAAGAGACAGAAGG + Intergenic
975364737 4:73516390-73516412 AGACAGATCAATGAGACAGAAGG - Intergenic
975500327 4:75077789-75077811 AGACAGATCAAAGAGACAGAAGG - Intergenic
975528961 4:75380688-75380710 AGACAGATCAACGAGACAGAAGG + Intergenic
975744393 4:77462139-77462161 AGACAGATCAATGAGACAGAAGG - Intergenic
976083667 4:81385033-81385055 AGACAGATCAATGAGACAGAAGG + Intergenic
976236850 4:82906525-82906547 AGGATGATCAAGAAGAGAAAGGG + Exonic
976272333 4:83243383-83243405 AGACAGATCAACGAGACAGAAGG + Intergenic
976529676 4:86137115-86137137 AGACAGATCAACGAGACAGAAGG + Intronic
976548930 4:86371962-86371984 AGACAGATCAATGAGACAGAAGG + Intronic
976585619 4:86793434-86793456 AGACAGGTCAACAAGACAGAAGG + Intronic
976760306 4:88541522-88541544 AGACAGATCAGCAAGACAGAAGG + Intronic
976974664 4:91152035-91152057 AGACAGATCAACGAGACAGAAGG - Intronic
976975640 4:91163492-91163514 AGGCAGATCAACAAGACAGAAGG - Intronic
977057478 4:92211678-92211700 AGACAGATCAACGAGACAGAAGG + Intergenic
977326239 4:95578352-95578374 AGACAGATCAACAAGACAGAAGG - Intergenic
977797403 4:101183192-101183214 TGGCAGAGCAACAAGACAGAAGG - Intronic
977906218 4:102480471-102480493 AGACAGATCAGCAAGACAGAAGG + Intergenic
977946718 4:102921991-102922013 AGAAAGATCAAGAAGACAGAAGG + Intronic
977951098 4:102971068-102971090 AGACAGATCAATGAGACAGAAGG + Intronic
978006878 4:103627724-103627746 AGACAGATCAACAAGACAGAAGG + Intronic
978205076 4:106071659-106071681 AGACAGATCAACAAGACAGAAGG - Intronic
978269634 4:106873657-106873679 AGACAGATCAACTAGACAGAAGG - Intergenic
978464789 4:108996552-108996574 AGACAGATCAACAAGACAGAAGG + Intronic
978641272 4:110874362-110874384 AGACAGATCAACAAGACAGAAGG - Intergenic
978929172 4:114289616-114289638 AGACAGATCAATGAGACAGAAGG + Intergenic
979272613 4:118780662-118780684 AGACAGATCAATGAGACAGAAGG - Intronic
979310754 4:119200241-119200263 AGACAGATCAATGAGACAGAAGG + Intronic
979326319 4:119384211-119384233 AGACAGATCAACGAGACAGAAGG - Intergenic
979462459 4:120999589-120999611 GGACAGATCAACAAGACAGAAGG - Intergenic
979516809 4:121618804-121618826 AGACCGATCAATGAGACAGAAGG + Intergenic
979581631 4:122367357-122367379 AGACAGATCAATGAGACAGAAGG + Intergenic
979750445 4:124272928-124272950 AGACAGATCAATGAGACAGAAGG - Intergenic
979757851 4:124363804-124363826 AGACAGATCAATGAGACAGAAGG + Intergenic
980197015 4:129602374-129602396 AGGCAGATCAAAAACACACAAGG - Intergenic
980593773 4:134926573-134926595 AGACAGATCAACGAGACAGAAGG - Intergenic
981008046 4:139896039-139896061 AGGATGATGAGGCAGACAGAAGG - Intronic
981255020 4:142650801-142650823 AGACAGATCAACGAGACAGAAGG + Intronic
981439929 4:144771120-144771142 AGGCAGATCAACGAGACACAAGG + Intergenic
981479776 4:145226639-145226661 AGACAGATCAACGAGACAGAAGG - Intergenic
981496570 4:145400403-145400425 AGACAGATCAACAAGACAGAAGG - Intergenic
981512929 4:145576917-145576939 AGACAGATCAACAAGACAGAAGG + Intergenic
981555290 4:145986989-145987011 AGTCAGTTCAACAAGACAGAAGG + Intergenic
981560711 4:146045826-146045848 AGACAGATCAATGAGACAGAAGG - Intergenic
981796057 4:148596836-148596858 AGACAGATTAACAAGACAGAAGG - Intergenic
981984484 4:150837356-150837378 AGACAGATCAACGAGACAGAAGG - Intronic
982327870 4:154148144-154148166 AGACAGATCAATGAGACAGAAGG - Intergenic
982785443 4:159531597-159531619 AGACAGATCAATGAGACAGATGG - Intergenic
982860667 4:160444920-160444942 TGGTTGCTCCAGAAGACAGATGG + Intergenic
983244183 4:165268877-165268899 AGACAGATCAACGAGACAGAAGG - Intronic
983685061 4:170398459-170398481 ATGCTGATAAAGAAAACAAAAGG + Intergenic
983771662 4:171557684-171557706 AGGCAGATCATGAAGTCAGAAGG - Intergenic
984224655 4:177019789-177019811 AGACAGATCAACGAGACAGAAGG + Intergenic
985367120 4:189243551-189243573 AGACAGATCAACAAGACAGAAGG - Intergenic
985473016 5:57831-57853 AAGCTGAACAAGAAGAGATATGG - Intergenic
986043888 5:4019346-4019368 AGGCTGTTCCAGAAGCCGGAAGG - Intergenic
986126851 5:4891133-4891155 AGACAGATCAATGAGACAGAAGG - Intergenic
986656128 5:10014576-10014598 AGACAGATCAACAAGACAGAAGG - Intergenic
986679736 5:10221987-10222009 AGGCTGGTGGAGCAGACAGACGG - Intergenic
987180148 5:15358698-15358720 AGACAGATCAACAAGACAGAAGG + Intergenic
987838255 5:23188709-23188731 AGACAGATCAACGAGACAGAAGG + Intergenic
987873054 5:23645543-23645565 AGACAGATCAATGAGACAGACGG - Intergenic
988172519 5:27677951-27677973 AGACAGATCAACAAGACAGAAGG + Intergenic
988187600 5:27887434-27887456 AGACAGATCAACAAGACAGAAGG - Intergenic
988671978 5:33391262-33391284 AGACAGATCAAGGAGACAGAAGG + Intergenic
988687857 5:33542443-33542465 AGACAGATCAAGGAGACAGAAGG + Intronic
988794870 5:34644237-34644259 AGACAGATCAAGGAGACAGAAGG - Intergenic
989315536 5:40073988-40074010 AGTCTGATAAAGGATACAGATGG + Intergenic
989349680 5:40472298-40472320 AGACAGATCAATAAGACAGAAGG - Intergenic
989517052 5:42355749-42355771 AGACAGATCAACAAGACAGAAGG + Intergenic
989522212 5:42415875-42415897 AGACAGATCAACAAGATAGAAGG - Intergenic
989614504 5:43326450-43326472 AGACACATCAACAAGACAGAAGG - Intergenic
989701448 5:44270086-44270108 AGGCTTATCTAGAGGACATACGG - Intergenic
989776982 5:45220847-45220869 AGGTTGAGTCAGAAGACAGAAGG - Intergenic
990148723 5:52791502-52791524 AGGCTGAGCAAGACATCAGAGGG - Intronic
990230068 5:53703744-53703766 AGACAGATCAACAAGACAGAGGG - Intergenic
990234676 5:53754022-53754044 AGACAGATCAATGAGACAGAAGG + Intergenic
990239437 5:53801887-53801909 AGACAGATCAATGAGACAGAAGG + Intergenic
990244627 5:53852249-53852271 AGACAGATCAATGAGACAGAAGG - Intergenic
990369150 5:55099096-55099118 AGACAGATCAACGAGACAGAAGG + Intergenic
990505083 5:56435861-56435883 AAGCAGACCAAGAAGATAGAAGG + Intergenic
990657160 5:57970176-57970198 AGACAGATCAATGAGACAGAAGG - Intergenic
990681802 5:58253224-58253246 AGGATGGGCAAGAGGACAGAGGG + Intergenic
990736052 5:58863625-58863647 AGGCTTAGCAAGAAAAAAGACGG + Intergenic
991199762 5:63978451-63978473 AGGCAGATCAAAGTGACAGAAGG - Intergenic
991280527 5:64908446-64908468 AGACAGATCAACGAGACAGAAGG - Intronic
991377628 5:65983200-65983222 ATTCTGATCAAGAAGAAAGCTGG - Intronic
992516944 5:77503456-77503478 AGACAGATCAACAAGACAGAAGG + Intronic
992604186 5:78438775-78438797 AGACAGATCAACAAGACAGAAGG - Intronic
992700709 5:79339289-79339311 AGACAGATCAATGAGACAGAAGG - Intergenic
992854264 5:80844460-80844482 AGACAGATCAATGAGACAGAAGG - Intronic
992879365 5:81091030-81091052 AGACTCAGAAAGAAGACAGATGG - Intronic
992894792 5:81236557-81236579 ATGCTCAAAAAGAAGACAGAAGG + Intronic
993043863 5:82845613-82845635 AGACAGATCAACGAGACAGAAGG - Intergenic
993438065 5:87922530-87922552 AGACAGATCAACGAGACAGAAGG - Intergenic
993471099 5:88308311-88308333 AGACAGATCAATGAGACAGAAGG + Intergenic
993497189 5:88621006-88621028 AGACAGATCAATGAGACAGAAGG - Intergenic
993656069 5:90579667-90579689 AGACAGATCAACGAGACAGAAGG - Intronic
993679534 5:90858958-90858980 ATTCTGATCAAAAAGACACAAGG - Intronic
994192259 5:96881664-96881686 TGGCTGAGCAGAAAGACAGAAGG - Intronic
994308540 5:98238248-98238270 AGACAGATCAATGAGACAGAAGG - Intergenic
994581319 5:101646339-101646361 AGACAGATCAACGAGACAGAAGG - Intergenic
994636809 5:102353885-102353907 AGACAGATCAATGAGACAGAAGG + Intergenic
995178363 5:109205353-109205375 AGACTGATCAAGGAGAAAAAGGG + Intergenic
995459990 5:112392670-112392692 AGACAGATCAATGAGACAGAAGG + Intronic
995489590 5:112677040-112677062 AGACAGATCAATGAGACAGAAGG - Intergenic
995563981 5:113414329-113414351 AGACAGATCAATGAGACAGAAGG - Intronic
995670839 5:114600600-114600622 AGACAGATCAATGAGACAGAAGG + Intergenic
995812593 5:116124630-116124652 AGACAGATCAATGAGACAGAAGG - Intronic
995909883 5:117173901-117173923 TGGCATATCAAGAAAACAGAAGG + Intergenic
996100646 5:119441609-119441631 AGACAGATCAACGAGACAGAAGG + Intergenic
996147057 5:119989703-119989725 AGACAGATCAACAAGACAGAAGG - Intergenic
996274501 5:121648236-121648258 AGACAGATCAATGAGACAGAAGG - Intergenic
996339099 5:122416445-122416467 AGGATGAGCAAGCAGCCAGAAGG + Intronic
996353716 5:122574080-122574102 AGGCAGAGCAAGAAGAAAAAAGG + Intergenic
996682926 5:126248026-126248048 AGACAGATCAACAAGACAGAAGG - Intergenic
996782226 5:127199717-127199739 AGACAGATCAACAAGACAGAAGG + Intergenic
996859335 5:128046494-128046516 AGACAGATCAAACAGACAGAAGG + Intergenic
996870721 5:128190257-128190279 TGGCTGATCCATAAGATAGATGG + Intergenic
996881046 5:128297398-128297420 AGACAGATCAACGAGACAGAAGG - Intronic
997077017 5:130690864-130690886 TGGATGAACAACAAGACAGAAGG - Intergenic
997097194 5:130926134-130926156 AGACCGATCAACAAGACAGAAGG + Intergenic
997245722 5:132347325-132347347 AGACAGATCAATGAGACAGAAGG - Intergenic
997743947 5:136282286-136282308 AGGCTGATGAAGGAATCAGAGGG + Intronic
998381997 5:141732250-141732272 AGGGAGATCTAGATGACAGAGGG - Intergenic
999472901 5:151871788-151871810 AGGCAGATCACGAAGTCAGGAGG - Intronic
999559983 5:152790134-152790156 AGACAGATCAACGAGACAGAAGG + Intergenic
999944378 5:156579473-156579495 AGACAGATCAACGAGACAGAAGG - Intronic
999965882 5:156808738-156808760 AGACAGATCAAGGAGACAGAAGG + Intergenic
1000591851 5:163167624-163167646 AGACAGATCAATGAGACAGAAGG + Intergenic
1001072164 5:168596114-168596136 AGACAGATCAACGAGACAGAAGG - Intergenic
1001076624 5:168633316-168633338 AGACAGATCAATGAGACAGAAGG + Intergenic
1001315719 5:170639967-170639989 TGGCAGAACAAGAAGGCAGAAGG - Intronic
1002672854 5:180883953-180883975 AGGTAGATCAATGAGACAGAAGG - Intergenic
1003165630 6:3675768-3675790 AGACAGATCAATGAGACAGAAGG - Intergenic
1003496807 6:6670739-6670761 AGACAGATCAATGAGACAGAAGG + Intergenic
1003647746 6:7928264-7928286 AAACAGATCAATAAGACAGAAGG + Intronic
1003764111 6:9216033-9216055 AGACAGATCAACAAGACAGAAGG + Intergenic
1003971255 6:11301447-11301469 AGACAGATCAATGAGACAGAAGG + Intronic
1003987806 6:11454397-11454419 AGACAGATCAATGAGACAGAAGG + Intergenic
1004056306 6:12141964-12141986 AGACAGATCAACAAGACAGAAGG + Intronic
1004207120 6:13601932-13601954 TAGCTGATCAAAAAGACACATGG - Intronic
1004250125 6:14016694-14016716 TGTTTGATCAAGAAGACAGAAGG - Intergenic
1004774612 6:18829623-18829645 AGGCTGATCAATAGCACTGAAGG + Intergenic
1005610434 6:27518716-27518738 AGGCTGAGGAAGGAGGCAGAGGG - Intergenic
1005747440 6:28851346-28851368 AGACAGATCAATGAGACAGAAGG + Intergenic
1005936232 6:30523402-30523424 AGACAGATCAATGAGACAGAAGG + Intergenic
1006733833 6:36257405-36257427 TGGCAGAGCAAGAAGACAGAAGG - Intronic
1007846874 6:44766351-44766373 AGACAGATCAATGAGACAGAAGG - Intergenic
1008094991 6:47330418-47330440 AGACAGATCAATAAGACAGAAGG + Intergenic
1008127434 6:47684700-47684722 AGGCTGATGGAGCAGACAGAGGG + Intronic
1008181045 6:48329493-48329515 ATTCTGAGCCAGAAGACAGAAGG + Intergenic
1008533533 6:52487852-52487874 TGGCTCAACAAGAAAACAGAGGG - Intronic
1008594973 6:53032967-53032989 AGGCTGTGGAAGAAGCCAGAGGG + Intronic
1008734827 6:54530054-54530076 AGACAGATCAATGAGACAGAAGG + Intergenic
1008805802 6:55426369-55426391 AGGATGATGAAGCAGAAAGATGG + Intergenic
1008963486 6:57290435-57290457 AGACAGATCAATGAGACAGAAGG + Intergenic
1009299869 6:62003596-62003618 AGACAGATCAAAGAGACAGAAGG + Intronic
1009655856 6:66543484-66543506 AGACAGATCAACAAGACAGAAGG + Intergenic
1009679461 6:66873315-66873337 AGACAGATCAATGAGACAGAAGG - Intergenic
1009987891 6:70804049-70804071 AGACAGATCAACGAGACAGAAGG - Intronic
1010004119 6:70976729-70976751 AGACAGATCAATGAGACAGAAGG + Intergenic
1010542148 6:77104555-77104577 AGGCTTATCATGAAAAAAGATGG - Intergenic
1010727272 6:79349343-79349365 AGACAGATCAACAAGACAGAAGG + Intergenic
1011213753 6:84982621-84982643 AGACAGATGAACAAGACAGAAGG + Intergenic
1011244273 6:85305776-85305798 AGACAGATCAACGAGACAGAAGG - Intergenic
1011884861 6:92080870-92080892 AGGCAGATCAACAAGACAGAAGG + Intergenic
1011909944 6:92423329-92423351 AGACAGATCAAGGAGTCAGAAGG + Intergenic
1012585024 6:100911683-100911705 AGACAGATCAACAAGACAGAAGG - Intergenic
1012589492 6:100962671-100962693 AGCCTGATCTGGAAAACAGATGG - Intergenic
1012882061 6:104802297-104802319 AGACAGATCAACATGACAGAAGG + Intronic
1012941239 6:105417587-105417609 AGACAGATCAATGAGACAGAAGG + Intergenic
1013624274 6:111921166-111921188 AGGATGAACAAAAGGACAGATGG - Intergenic
1013895519 6:115083151-115083173 AGACAGATCAACGAGACAGAAGG + Intergenic
1014176729 6:118339428-118339450 AGACTAATAAAGAAGAAAGAGGG - Intergenic
1014352759 6:120364280-120364302 AGACAGATCAACAATACAGAAGG + Intergenic
1014461860 6:121705509-121705531 AGACAGATCAAGGAGACAGAAGG + Intergenic
1014907356 6:127045826-127045848 AGACAGATCAACGAGACAGAAGG + Intergenic
1014938308 6:127410167-127410189 AGACAGATCAACAAGACAGAAGG - Intergenic
1015046046 6:128777759-128777781 AGACAGATCAACAAGACAGAAGG - Intergenic
1015133268 6:129838002-129838024 AGACAGATCAACAAGACAGAAGG + Intronic
1015177406 6:130325436-130325458 AGCCTGAACAATAAGACAGAGGG - Intronic
1015197632 6:130541169-130541191 AGACAGATCAAGGAGGCAGAAGG + Intergenic
1015446939 6:133317148-133317170 TGGCTTATCAAAAAGTCAGAAGG + Intronic
1015931522 6:138365244-138365266 AGACAGATCAACGAGACAGAAGG + Intergenic
1016005774 6:139087979-139088001 AGACAGATCAATGAGACAGAAGG - Intergenic
1016202220 6:141426511-141426533 AGGCTGGAGAAGAAGACACATGG - Intergenic
1016316443 6:142793766-142793788 AGGCTGAGGCAGAAGGCAGAGGG - Intronic
1016523650 6:144975285-144975307 AGACAGATCAACAAGACAGAAGG - Intergenic
1016585156 6:145675862-145675884 AGACAGATCAACAAAACAGAAGG + Intronic
1017231829 6:152081055-152081077 AAACAGATCAACAAGACAGAAGG + Intronic
1017279876 6:152611577-152611599 AGACAGATCAATGAGACAGAAGG + Intronic
1017303129 6:152885220-152885242 AGACAGATCAATGAGACAGAAGG + Intergenic
1017660169 6:156666082-156666104 AGACAGATCAACAAGACAGAAGG + Intergenic
1018079123 6:160243664-160243686 AGGATGATCATGAAGGCAGCTGG + Exonic
1018238860 6:161753249-161753271 AAGCTAATAAAGGAGACAGAAGG + Intronic
1020343944 7:7143142-7143164 AGACAGATCAATGAGACAGAAGG - Intergenic
1020795803 7:12677478-12677500 AGACAGATCAACAAGACAGAAGG + Intergenic
1022347524 7:29530989-29531011 AGACAGATCAATGAGACAGAAGG + Intergenic
1022459347 7:30589829-30589851 AGACTAATCAAGAAAAGAGAGGG + Intergenic
1022891197 7:34701565-34701587 AGGCAGATTAATAAGAGAGAAGG - Intronic
1022900128 7:34800147-34800169 AGACAGATCAACGAGACAGAAGG + Intronic
1022901663 7:34816497-34816519 AGACAGATCAACGAGACAGAAGG + Intronic
1023065815 7:36376652-36376674 AGACAGATCAACGAGACAGAAGG - Intronic
1023509154 7:40932485-40932507 AGACGGATCAATGAGACAGAAGG - Intergenic
1023537524 7:41229300-41229322 AGACAGATCATCAAGACAGAAGG - Intergenic
1023650965 7:42369002-42369024 AGACAGATCAATGAGACAGAAGG - Intergenic
1024641820 7:51335298-51335320 TGGCTTATACAGAAGACAGATGG - Intergenic
1024666820 7:51555693-51555715 AGACAGAGCAACAAGACAGAAGG - Intergenic
1024817249 7:53285887-53285909 AGACAGATTAATAAGACAGAAGG - Intergenic
1024956032 7:54921925-54921947 AGACAGATCAACTAGACAGAAGG - Intergenic
1025582650 7:62739663-62739685 AGACTAATAAAGAAGAAAGATGG - Intergenic
1025720787 7:64010805-64010827 AGACAGATCAACAAGACAGAAGG - Intergenic
1026632343 7:72048338-72048360 AGGATGATTAAGAAGAGATATGG - Intronic
1027868663 7:83678350-83678372 AAGAAGAGCAAGAAGACAGATGG + Intergenic
1028004107 7:85540703-85540725 AGACAGATCAATGAGACAGAAGG - Intergenic
1028114741 7:86984266-86984288 AGACAGATCAATGAGACAGAAGG + Intronic
1028412757 7:90548953-90548975 AGACAGATCAATGAGACAGAAGG - Intronic
1028482693 7:91325070-91325092 AGGCTGAGAAAAAACACAGATGG + Intergenic
1028663839 7:93317138-93317160 GGGCCTATCAAGAAGAAAGAAGG + Intronic
1028691813 7:93661590-93661612 AGACAGATCAATAAGAGAGAAGG - Intronic
1029006292 7:97213600-97213622 AGACAGATCAATGAGACAGATGG - Intergenic
1029053117 7:97710574-97710596 AGACAGATCAACAAGACAGAAGG - Intergenic
1029062524 7:97812911-97812933 AGACAGATCAATGAGACAGAAGG + Intergenic
1029249122 7:99223455-99223477 AGGCAGATCACGAGGTCAGATGG + Intergenic
1029313671 7:99691457-99691479 AGACAGATCAATGAGACAGAAGG - Intronic
1029810307 7:103040405-103040427 AGACAGATCAATGAGACAGAAGG + Intronic
1029902953 7:104061372-104061394 AGACAGATCAATGAGACAGAAGG + Intergenic
1029951730 7:104593600-104593622 AGACAGATCAACAAGACAGAAGG - Intronic
1030029965 7:105359939-105359961 AGACAGATCAACGAGACAGAAGG - Intronic
1031157321 7:118124791-118124813 AGACAGATCAACAAGACAGAAGG + Intergenic
1031366216 7:120903281-120903303 AGACAGATCAACGAGACAGAAGG + Intergenic
1031543548 7:123025428-123025450 TAGCTGATCAAGAAGTCACAAGG - Intergenic
1031612307 7:123842558-123842580 AGACAGATCAACATGACAGAAGG - Intronic
1031803782 7:126281380-126281402 AGACAGATCAATGAGACAGAAGG - Intergenic
1031905281 7:127453527-127453549 AGACAGATCAGGGAGACAGAAGG + Intergenic
1032167456 7:129556643-129556665 AGACTGATAAAGAAGAAAGGGGG + Intergenic
1032250450 7:130252579-130252601 AGACAGATCAATGAGACAGAAGG - Intergenic
1032379918 7:131468010-131468032 AGGGTGAGCAAGAAGAGTGAAGG + Intronic
1034039867 7:147866480-147866502 AGACAGATCAATGAGACAGAAGG - Intronic
1034076804 7:148239846-148239868 ATCCTGCTGAAGAAGACAGAAGG + Intronic
1034394430 7:150810135-150810157 AGACAGATCAACAAGACAGAAGG + Intergenic
1035083522 7:156236914-156236936 AGGCTGAGCAAGAACAAAAAAGG + Intergenic
1035166289 7:156992283-156992305 AGTCTGATTCAGAAAACAGAGGG - Intergenic
1036644147 8:10601571-10601593 AGGCTGAGGACGAGGACAGAGGG + Intergenic
1036656468 8:10680480-10680502 AGACTCATCAAACAGACAGAAGG + Intronic
1036656605 8:10681275-10681297 AGGCTGGCCAAGAAGGCACAAGG - Intronic
1037398573 8:18469491-18469513 AGACAGATCAACGAGACAGAAGG + Intergenic
1037557404 8:20038865-20038887 AGACAGATCAACGAGACAGAAGG - Intergenic
1037608073 8:20454155-20454177 GGGGTGAACAAGGAGACAGAGGG - Intergenic
1037929443 8:22869117-22869139 AGGCAGAGAAAGAAGGCAGAGGG - Intronic
1038873071 8:31517694-31517716 AGACAGATCAACAAGACAGAAGG - Intergenic
1039036282 8:33362851-33362873 AGACAGATCAATGAGACAGAAGG + Intergenic
1039337861 8:36612795-36612817 AGACTGACCAAGAAGAAAGAGGG - Intergenic
1039633805 8:39141751-39141773 AGACAGATCAACAAGACAGAAGG - Intronic
1039676520 8:39674184-39674206 AGACAGATCAACGAGACAGAAGG - Intronic
1039832608 8:41227551-41227573 AGACAGATCAATGAGACAGAAGG + Intergenic
1040013850 8:42684339-42684361 AGACAGATCAATGAGACAGAAGG + Intergenic
1040473650 8:47758126-47758148 AGACAGATCAACGAGACAGAAGG - Intergenic
1040556934 8:48488138-48488160 AGACAGATCAATGAGACAGAAGG + Intergenic
1040606866 8:48942656-48942678 AGACAGATCAATGAGACAGAAGG - Intergenic
1040780908 8:51108283-51108305 AGGCTGAGAACCAAGACAGAAGG + Intergenic
1041213242 8:55573840-55573862 AGACAGATCAACGAGACAGAAGG + Intergenic
1041221785 8:55658724-55658746 AGACACATCAACAAGACAGAAGG + Intergenic
1041229866 8:55738571-55738593 AGGCTCCTTCAGAAGACAGAAGG + Intronic
1041634519 8:60128224-60128246 AGACAGATCAACGAGACAGAAGG - Intergenic
1041748797 8:61237082-61237104 AGGATGATCAGTAAGACAAAGGG + Intronic
1041815645 8:61967873-61967895 AGACAGATCAAGGAGACAGAAGG - Intergenic
1041910098 8:63079750-63079772 AGACAGATCAATGAGACAGAAGG + Intronic
1041943407 8:63414176-63414198 AGACTGATCAAGGAGAAAAAAGG - Intergenic
1042023998 8:64403425-64403447 AGACAGATCAACGAGACAGAAGG - Intergenic
1042511308 8:69614900-69614922 AGACTGATAAATCAGACAGAAGG + Intronic
1042811520 8:72830655-72830677 AGCATGATCAAGTACACAGATGG - Intronic
1042833701 8:73058328-73058350 AGACAGATCAATGAGACAGAAGG + Intergenic
1042931535 8:74018503-74018525 AGACAGATCAATGAGACAGAAGG + Intronic
1043088955 8:75873938-75873960 AGACAGATCAAAGAGACAGAAGG - Intergenic
1043109351 8:76159063-76159085 AAGCTGATGAAGAAAAGAGAAGG + Intergenic
1043129172 8:76439974-76439996 AGACAGATCAACAAGACAGAAGG - Intergenic
1043330666 8:79114508-79114530 AGACAGATCAATGAGACAGAAGG + Intergenic
1044074000 8:87795716-87795738 AGACAGATCAACGAGACAGAAGG + Intergenic
1044314342 8:90732317-90732339 AGACAGATCAATGAGACAGAAGG - Intronic
1044385564 8:91584198-91584220 AGACCGATCAACGAGACAGAAGG - Intergenic
1044448954 8:92311744-92311766 AGACAGATCAATAAGACAGAAGG - Intergenic
1044534974 8:93348095-93348117 AGGCTGACCAACCAGACAAAAGG - Intergenic
1044576712 8:93777914-93777936 AGGCAGATCAACAAGACAGAAGG - Intronic
1044746147 8:95373268-95373290 AGACAGATCAACGAGACAGAAGG - Intergenic
1044767418 8:95591578-95591600 AGACAGATCAACGAGACAGAAGG - Intergenic
1044798707 8:95931446-95931468 AGACAGATCAATGAGACAGAAGG - Intergenic
1044931459 8:97255699-97255721 AGGTTGATCAAGGAGTCAAATGG - Intergenic
1044956373 8:97485671-97485693 AGACAGATCAATGAGACAGAAGG - Intergenic
1045205249 8:100032597-100032619 AGACAGATCAATGAGACAGAAGG + Intronic
1046435924 8:114189541-114189563 AGACAGATCAACAAGACGGAAGG + Intergenic
1046608152 8:116393310-116393332 AGACAGATCAATGAGACAGAAGG + Intergenic
1046887103 8:119379240-119379262 AGACAGATCAATGAGACAGAAGG + Intergenic
1047129584 8:122003834-122003856 AGACAGATCAACCAGACAGAAGG + Intergenic
1047473197 8:125199737-125199759 AGACTGATAAACAAGACAGAAGG - Intronic
1048149562 8:131881262-131881284 AGACAGATCAATGAGACAGAAGG - Intergenic
1048288637 8:133162806-133162828 AGGAATATCAAGAAGACAGTTGG - Intergenic
1048942051 8:139408343-139408365 AGGCAGATCACGAAGTCAGGAGG + Intergenic
1049268595 8:141682462-141682484 CGTCTGGTCAAGAAGACAGAAGG - Intergenic
1049295992 8:141838836-141838858 AGGCTGGAAAAGAAGAAAGAGGG - Intergenic
1049485081 8:142852513-142852535 AGACAGATCAACGAGACAGAAGG + Intronic
1050320952 9:4451429-4451451 AGACAGATCAACAAGACAGAAGG + Intergenic
1050387245 9:5103501-5103523 AGACAGATCAATGAGACAGAAGG + Intronic
1050407974 9:5329840-5329862 AGACAGATCAATGAGACAGAAGG + Intergenic
1050590832 9:7158902-7158924 AGACAGATCAACGAGACAGAAGG - Intergenic
1050603913 9:7281246-7281268 AGACAGATCAACGAGACAGAAGG - Intergenic
1051303098 9:15674921-15674943 AGACAGATCAACGAGACAGAAGG - Intronic
1052770741 9:32686695-32686717 AGACAGATCAACGAGACAGAAGG + Intergenic
1052888223 9:33669912-33669934 AGACAGATCAACGAGACAGAAGG + Intergenic
1053437050 9:38082878-38082900 AGACTGAGAAAGATGACAGACGG - Intergenic
1053751500 9:41261543-41261565 AGACAGATCAACAAGACAGAAGG - Intergenic
1054257022 9:62825872-62825894 AGACAGATCAACAAGACAGAAGG - Intergenic
1054334277 9:63789631-63789653 AGACAGATCAACAAGACAGAAGG + Intergenic
1055829239 9:80359850-80359872 AGGCTTCTGAAGGAGACAGAGGG - Intergenic
1056668314 9:88599895-88599917 AGACAGATCAACCAGACAGAAGG + Intergenic
1056671849 9:88636598-88636620 AGACAGATCATCAAGACAGAGGG - Intergenic
1056996891 9:91471081-91471103 AGACAGATCAACGAGACAGAAGG - Intergenic
1057282410 9:93722375-93722397 AGGCTGAGCAGAAAGACAGAAGG - Intergenic
1057392480 9:94651308-94651330 AGGCTCACTAAGAAGGCAGATGG - Intergenic
1057557170 9:96097338-96097360 GGCCTGATCCTGAAGACAGAGGG - Intergenic
1057768846 9:97948910-97948932 AAACAGATCAACAAGACAGAAGG - Intergenic
1057902372 9:98959651-98959673 AGGCAGGGCAAGAAGATAGAAGG - Intronic
1058400808 9:104617049-104617071 AGTAGGATGAAGAAGACAGAGGG - Intergenic
1058594110 9:106596761-106596783 AAAATGATCAAGAAGACAGAGGG + Intergenic
1059562837 9:115351866-115351888 AGACTCATGAGGAAGACAGATGG - Intronic
1059788454 9:117613004-117613026 AAGTTGAACAAGAAGAAAGAAGG - Intergenic
1059864429 9:118499042-118499064 AGACAGATCAATGAGACAGAAGG - Intergenic
1060037884 9:120273626-120273648 AGACAGATCAATGAGACAGAAGG - Intergenic
1060133703 9:121131192-121131214 AGACAGATCAACAAGACAGAAGG - Intronic
1060383608 9:123201115-123201137 AGATTAATCAAGAAGAGAGAAGG - Intronic
1061552136 9:131342939-131342961 AGACAGATCAACAAGACAGAAGG - Intergenic
1061574757 9:131499188-131499210 AGGCAGATCCAGAAGATAGGAGG - Exonic
1061976799 9:134072517-134072539 AGGCAGGACAAGAAGACAGGTGG + Intergenic
1062082149 9:134629840-134629862 AGGCTGACCAAGAAGGCACCAGG - Intergenic
1203491874 Un_GL000224v1:114539-114561 AGACAAATCAACAAGACAGAAGG - Intergenic
1203504498 Un_KI270741v1:56410-56432 AGACAAATCAACAAGACAGAAGG - Intergenic
1185806467 X:3061882-3061904 AGACAGATCAACGAGACAGAAGG + Intronic
1186585887 X:10872406-10872428 AGACAGATCAATGAGACAGAAGG + Intergenic
1187248120 X:17572227-17572249 AGACAGATCAACAAGACAGGAGG - Intronic
1187594609 X:20756992-20757014 AGACAGATCAACGAGACAGAAGG + Intergenic
1187705162 X:22003008-22003030 AGACAGATCAATGAGACAGAAGG - Intergenic
1187769508 X:22679394-22679416 AGACAGATCAATGAGACAGAAGG + Intergenic
1188939692 X:36221904-36221926 TGACAGATCAAGCAGACAGAAGG + Intergenic
1189000447 X:36938466-36938488 TGGCTCAACAAGAAGGCAGAGGG - Intergenic
1189501514 X:41564664-41564686 AGACAGATCAATGAGACAGAAGG + Intronic
1189559484 X:42177413-42177435 AAGCAGATCAGGAAGACGGAAGG - Intergenic
1189763468 X:44345318-44345340 AGGCGGATCAAGAGGTCAGGAGG + Intergenic
1189936796 X:46078131-46078153 AGACAGATCAACGAGACAGAAGG - Intergenic
1190683175 X:52847045-52847067 AGACAGATCAACGAGACAGAAGG - Intergenic
1190979760 X:55445837-55445859 AGACAGATCAATGAGACAGAAGG + Intergenic
1190997801 X:55628232-55628254 AGACAGATCAACGAGACAGAAGG + Intergenic
1191012196 X:55772460-55772482 AGACAGATCAATGAGACAGAAGG - Intergenic
1191019986 X:55849325-55849347 AGACAGATCAACGAGACAGAAGG - Intergenic
1191042991 X:56105275-56105297 AGACAGATCAATGAGACAGAAGG - Intergenic
1191049950 X:56181023-56181045 AGACAGATCAATGAGACAGAAGG - Intergenic
1191073484 X:56427621-56427643 AGACAGATCAATGAGACAGAAGG - Intergenic
1191084529 X:56549790-56549812 AGACAGATCAACAAGACAGAAGG + Intergenic
1191122255 X:56918697-56918719 AGACAGATCAACAAGACAGAGGG - Intergenic
1191156194 X:57276003-57276025 AGACAGATCAATGAGACAGAAGG + Intergenic
1191645947 X:63480899-63480921 AGACAGATCAAGAAGACAGAAGG + Intergenic
1191733715 X:64366186-64366208 AGACAGATCAACGAGACAGAAGG + Intronic
1191757070 X:64605005-64605027 AGACAGATCAATGAGACAGAAGG - Intergenic
1191772215 X:64773587-64773609 AGACGGATCAACAAGACAGAAGG - Intergenic
1191772515 X:64776604-64776626 AGACAGATCAACGAGACAGAAGG - Intergenic
1191882186 X:65854192-65854214 AGACAGATCAAGGAAACAGAAGG - Intergenic
1191900874 X:66039753-66039775 AGGCTGCTGAAGAAGCCAGAAGG - Intronic
1191907146 X:66105862-66105884 AGACAGATCAATGAGACAGAAGG - Intergenic
1192160041 X:68778263-68778285 ACACAGATCAACAAGACAGAAGG + Intergenic
1192292092 X:69808939-69808961 GGGCTCATCAAGAAGGCAGCAGG + Intronic
1192293816 X:69826260-69826282 AGACAGATCAACAAGACAGAAGG - Intronic
1192294602 X:69834265-69834287 AGACAGATCAACAAGACAGAAGG - Intronic
1192335238 X:70213960-70213982 AGACAGATCAACGAGACAGAAGG - Intergenic
1192396134 X:70782910-70782932 AGACAGATCAACAAGACAGATGG + Intronic
1192613155 X:72588012-72588034 AGACAGATCAATGAGACAGAAGG + Intronic
1192654972 X:72983314-72983336 AGACAGATCAATGAGACAGAAGG + Intergenic
1192679064 X:73232168-73232190 AGACAGATCAACAAGACAGAAGG + Intergenic
1192703412 X:73500899-73500921 AGACAGATCAATGAGACAGAAGG + Intergenic
1192728056 X:73773083-73773105 AGACAGATCAATGAGACAGAAGG + Intergenic
1192826163 X:74698289-74698311 AGGCAGATCAACGAGACAGAAGG + Intergenic
1192896848 X:75452469-75452491 AGACAGATCAATGAGACAGAAGG + Intronic
1193001793 X:76570612-76570634 AGTCAGATCAACAAGACAGAAGG + Intergenic
1193054452 X:77135539-77135561 AGACAGATCAACGAGACAGAAGG - Intergenic
1193074071 X:77336537-77336559 AGACAGATCAATGAGACAGAAGG + Intergenic
1193281274 X:79653963-79653985 AGACAGATCAATGAGACAGAAGG - Intergenic
1193338836 X:80322010-80322032 AGACAGATCAACAAGACAGAAGG + Intergenic
1193343527 X:80380520-80380542 AGACAGATCAATGAGACAGAAGG - Intronic
1193367073 X:80647464-80647486 AGTCTAATGAAGAAGACAGAAGG - Intergenic
1193376645 X:80769172-80769194 AGACAGATCAATGAGACAGAAGG + Intronic
1193402846 X:81066231-81066253 AGACAGATCAATAAGACAGAAGG + Intergenic
1193641213 X:84011427-84011449 AGACAGATCAACGAGACAGAAGG + Intergenic
1193661607 X:84265387-84265409 AGACAGATCAACGAGACAGAAGG - Intergenic
1193806806 X:86004843-86004865 AGACAGATCAACGAGACAGAAGG + Intronic
1194342148 X:92718163-92718185 AGACAGATCAACCAGACAGAAGG + Intergenic
1194588704 X:95770180-95770202 AGACAGATCAACAATACAGAAGG + Intergenic
1194727162 X:97411983-97412005 AGACAGATCAATGAGACAGAAGG + Intronic
1194763987 X:97827832-97827854 AGGCTGAAGAAGAATAAAGAAGG + Intergenic
1194851733 X:98878781-98878803 TGGCAGATTAAGAAGATAGAAGG + Intergenic
1195163090 X:102190534-102190556 AGACAGATCAACGAGACAGAAGG - Intergenic
1195665309 X:107424272-107424294 AGACAGACCAACAAGACAGAAGG + Intergenic
1195846205 X:109231368-109231390 AGACAGATCAATGAGACAGAAGG + Intergenic
1195847717 X:109246563-109246585 AGACAGATCAATGAGACAGAAGG - Intergenic
1195988585 X:110659464-110659486 AGACAGATCAATGAGACAGATGG + Intergenic
1196012291 X:110901950-110901972 AGACAGATCAACGAGACAGAAGG - Intergenic
1196019378 X:110974144-110974166 AGACAGATCAATGAGACAGAAGG + Intronic
1196167232 X:112549221-112549243 AGACAGATCAATGAGACAGAAGG - Intergenic
1197414312 X:126155404-126155426 AGACAGATCAACGAGACAGAAGG + Intergenic
1197489994 X:127104467-127104489 AGACAGATCAACAAGACAGAAGG + Intergenic
1197718957 X:129731728-129731750 AGGCTCCTGAAGAGGACAGAAGG + Intergenic
1198293454 X:135261358-135261380 AGACAGATCAACAAGACAGAAGG - Intronic
1198422035 X:136477918-136477940 AGGCTGATCATGTGGACTGAGGG - Intergenic
1198595718 X:138233300-138233322 AGACAGATCAACAAGACAGAAGG + Intergenic
1198725584 X:139673877-139673899 AGACAGATCAACGAGACAGAAGG - Intronic
1199292591 X:146121448-146121470 AGACAGATCAAGGGGACAGAAGG + Intergenic
1199911586 X:152293112-152293134 AGACAGATCAACGAGACAGAAGG - Intronic
1199933336 X:152546964-152546986 AGACAGATCAACAAGACAGAAGG + Intergenic
1199939368 X:152610113-152610135 AGACAGATCAACGAGACAGAAGG - Intergenic
1199968279 X:152838859-152838881 AGACAGATCAACAAGACAGAAGG - Intronic
1200378709 X:155811376-155811398 AGACAGATCAACAAGACAGAAGG + Intergenic
1200650506 Y:5834859-5834881 AGACAGATCAACCAGACAGAAGG + Intergenic
1200810266 Y:7477374-7477396 AGACAGATCAATGAGACAGAAGG - Intergenic
1200976543 Y:9217593-9217615 TGTCTGATGCAGAAGACAGATGG + Intergenic
1201182400 Y:11361377-11361399 AGAAAGATCAACAAGACAGAAGG + Intergenic
1201350523 Y:13035638-13035660 AGACAGATCAACGAGACAGAAGG + Intergenic
1201450348 Y:14104708-14104730 AGACAGATCAAGGAGACAGAAGG + Intergenic
1201459731 Y:14208791-14208813 AGACAGATCAACAAGACAGAAGG + Intergenic
1201561259 Y:15319861-15319883 AGACAGATCAAAAAGACAGAAGG - Intergenic
1201752020 Y:17443344-17443366 AGACAGATCAACAAGACAGAAGG - Intergenic
1202065204 Y:20931946-20931968 AGACAGATCAATGAGACAGAAGG + Intergenic
1202091524 Y:21195710-21195732 AGACAGATCAATCAGACAGAAGG - Intergenic
1202241633 Y:22776848-22776870 AGACAGATCAATGAGACAGAAGG - Intergenic
1202249725 Y:22857379-22857401 AGACAGATCAAAGAGACAGAAGG + Intergenic
1202394616 Y:24410592-24410614 AGACAGATCAATGAGACAGAAGG - Intergenic
1202402712 Y:24491127-24491149 AGACAGATCAAAGAGACAGAAGG + Intergenic
1202468070 Y:25178956-25178978 AGACAGATCAAAGAGACAGAAGG - Intergenic
1202476168 Y:25259500-25259522 AGACAGATCAATGAGACAGAAGG + Intergenic