ID: 1180031507

View in Genome Browser
Species Human (GRCh38)
Location 21:45211805-45211827
Sequence CAGCCTGCAAAGAGGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180031507_1180031514 28 Left 1180031507 21:45211805-45211827 CCTAGTTCCCTCTTTGCAGGCTG 0: 1
1: 1
2: 1
3: 27
4: 263
Right 1180031514 21:45211856-45211878 CCCCACACTGCACTGGCCTCAGG 0: 1
1: 0
2: 0
3: 34
4: 320
1180031507_1180031516 29 Left 1180031507 21:45211805-45211827 CCTAGTTCCCTCTTTGCAGGCTG 0: 1
1: 1
2: 1
3: 27
4: 263
Right 1180031516 21:45211857-45211879 CCCACACTGCACTGGCCTCAGGG 0: 1
1: 0
2: 3
3: 22
4: 297
1180031507_1180031511 21 Left 1180031507 21:45211805-45211827 CCTAGTTCCCTCTTTGCAGGCTG 0: 1
1: 1
2: 1
3: 27
4: 263
Right 1180031511 21:45211849-45211871 CGTCAGCCCCCACACTGCACTGG 0: 1
1: 0
2: 0
3: 16
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180031507 Original CRISPR CAGCCTGCAAAGAGGGAACT AGG (reversed) Intronic
900092667 1:927234-927256 CTGCTTGAAAGGAGGGAACTGGG - Intronic
901875637 1:12165703-12165725 CAGCCTGCAGTGAGGAAACAGGG + Intergenic
901985778 1:13074198-13074220 CAGCATGAAAAGTGAGAACTGGG + Intronic
901996031 1:13152569-13152591 CAGCATGAAAAGTGAGAACTGGG - Intergenic
902397769 1:16141781-16141803 CCGCCAGGAAAGAGGGAATTTGG + Intronic
903472039 1:23593909-23593931 CAGCCAGCAAAGAGGTAGATTGG - Intronic
905470628 1:38189005-38189027 CAGCCTGCTAAGATGGTCCTGGG + Intergenic
906218615 1:44059816-44059838 CAGGCTGCAATGAGGTAAATGGG + Intergenic
906276134 1:44517339-44517361 GAGGCTGGAGAGAGGGAACTGGG - Intronic
907686247 1:56614693-56614715 CAGCAGGCAAAGAGTGAACTTGG + Intronic
907932477 1:59013530-59013552 CAGCTCGAGAAGAGGGAACTAGG + Intergenic
908113161 1:60916916-60916938 CAGCCAGCAAAAAGGGAAGGTGG + Intronic
909971197 1:81992127-81992149 CAGAGGGCAAAGAGGGCACTGGG + Exonic
910293794 1:85624333-85624355 CAGCATGAAAAGCAGGAACTTGG + Intergenic
911572218 1:99531963-99531985 CAGCCTTCAAAGTGGGGACTGGG - Intergenic
911689812 1:100820350-100820372 CAACCTGCAAAGCGGGAGCTTGG + Intergenic
912254988 1:108049156-108049178 CAGCCTGCAAAGAAGGACAAGGG + Intergenic
915882269 1:159684529-159684551 CAGTCTGCAAGGAGGGAGCTCGG + Intergenic
917405506 1:174702204-174702226 CACCATGCAGAGTGGGAACTTGG - Exonic
918436277 1:184516615-184516637 CAGCCGGCAAAGAGAGAATGAGG + Intronic
920866319 1:209756829-209756851 CAGGCTGCAGAGAGAGAACAGGG - Intronic
921482355 1:215677684-215677706 AAGACTGATAAGAGGGAACTAGG - Intronic
1062986647 10:1775240-1775262 TAGCCTGTAAAGATGGAAGTGGG + Intergenic
1063450601 10:6147664-6147686 TAGCCTGCAGAGAGGGAGCTGGG + Intronic
1064342466 10:14499574-14499596 GGGCCTGGAAAGAGGGAGCTGGG - Intergenic
1067061725 10:43081194-43081216 CAGCCTCCAAAGAAGGAAGGGGG - Intronic
1067672596 10:48337876-48337898 CAGCCTTCCAAGAGTGAACCAGG + Intronic
1068844750 10:61659222-61659244 AATCCTGCAGAGAGGGGACTGGG + Intergenic
1068930278 10:62582277-62582299 CAGCCTGCAAAGGAGTAAGTAGG - Intronic
1071481553 10:86068838-86068860 CTGCCAGCAGAGAGGGCACTTGG - Intronic
1071999634 10:91182004-91182026 CACCCTCCAAAGACTGAACTAGG - Intronic
1072402213 10:95115797-95115819 CAGCCTACCAAGATGGAATTAGG - Intergenic
1072686359 10:97539706-97539728 CGGCCTGCATGGAGGGAAGTGGG + Intronic
1075223188 10:120601985-120602007 TATCCTGGAAAGAGGGATCTCGG + Intergenic
1075715556 10:124553236-124553258 CAGCCTGACAAAGGGGAACTTGG + Intronic
1076377858 10:130003466-130003488 CTGCCTGCAAAGACAGAGCTGGG + Intergenic
1076464120 10:130666679-130666701 CAGGCTGAAAAGAGGGAAAGAGG + Intergenic
1077367849 11:2168368-2168390 GAGCCCGCAGAGAGGGAACCAGG + Intronic
1077596855 11:3540137-3540159 CAGCCTACCAAGATTGAACTAGG + Intergenic
1080164584 11:29221659-29221681 CAGCCTCCCAAGACTGAACTGGG - Intergenic
1080189504 11:29527055-29527077 CAGCCTCCAAAGAGTGAATCTGG - Intergenic
1080458210 11:32433782-32433804 CAGGATACAAGGAGGGAACTCGG - Intronic
1081622185 11:44625107-44625129 CAGCAGGCAAAGAGGGAGCAGGG + Intergenic
1082947634 11:58776553-58776575 CATCCTCCAAAGGGTGAACTCGG - Intergenic
1083137037 11:60688772-60688794 GAGCCTGCAGAGAGGGACCATGG + Intergenic
1083945229 11:65919598-65919620 CCGCCTGCCCAGCGGGAACTGGG - Intronic
1084252773 11:67914091-67914113 CAGCCTACCAAGATTGAACTAGG + Intergenic
1084430987 11:69111088-69111110 TAGACTACAAAGAGGGAAGTAGG - Intergenic
1084589271 11:70080671-70080693 AAGTCTGCAAAGAGGCAGCTGGG + Intronic
1084770145 11:71337420-71337442 CAGCCTGCACAGAGGGGAAAAGG + Intergenic
1084820090 11:71681933-71681955 CAGCCTACCAAGATTGAACTAGG - Intergenic
1085087412 11:73679467-73679489 CAGGCTGCAAAGGGTGCACTTGG + Intronic
1085267607 11:75246531-75246553 CAGCCTGGACAGAAGGAACCCGG - Intergenic
1085452400 11:76642558-76642580 CAGCCTTCAGAGAGGGGACTGGG - Intergenic
1085572945 11:77575162-77575184 CAGCCTCCAAAGAGAGAATCTGG - Intronic
1088373491 11:109116472-109116494 CTGCCTACAAAGAGGCAGCTAGG - Intergenic
1090737109 11:129619578-129619600 CAGGCTGAAAAGAGTGAAATCGG - Intergenic
1091066191 11:132515374-132515396 CAGGCTACAAGGAGGGAAATAGG + Intronic
1091093182 11:132792602-132792624 AAGCCAGCAAAGAGGTCACTTGG - Intronic
1091345781 11:134853065-134853087 CACAGTGCAAAGAGGGAACAAGG + Intergenic
1092423021 12:8348896-8348918 CAGCCTACCAAGATTGAACTAGG + Intergenic
1093722300 12:22458770-22458792 CAGCCTGCTAACTGAGAACTTGG - Intronic
1093920088 12:24849803-24849825 GAGCCTGGAAAGGTGGAACTGGG - Exonic
1095642683 12:44502706-44502728 AACCCTGCGAAGAGGGAAATTGG + Intergenic
1098376338 12:69819578-69819600 CAGCCTGCAAAGACGAAAGGAGG + Exonic
1099216652 12:79861721-79861743 CAACCTGCAATGTGGGAGCTTGG + Intronic
1104373273 12:128243034-128243056 CAGAGTGCAAAAAAGGAACTGGG - Intergenic
1105240985 13:18609605-18609627 CAGCCTGCGCAGCGGGCACTCGG - Intergenic
1107042404 13:35963238-35963260 AAACCTGCAAAGGGTGAACTGGG + Intronic
1107825287 13:44323961-44323983 CAGCTTGCAAAGAGGGAAGAGGG - Intergenic
1110512936 13:76374447-76374469 CAGAATGCAAAAAGGGAAGTTGG - Intergenic
1112032434 13:95470097-95470119 AACCCTGCAAATATGGAACTAGG + Intronic
1112446888 13:99472270-99472292 CAGCACCCAAAGAAGGAACTGGG - Intergenic
1113891060 13:113735858-113735880 GAGCCTGCACAGAGGGACCTGGG - Exonic
1115523803 14:34259329-34259351 CTGTCTGCAAAGAGGAAAGTGGG + Intronic
1117208431 14:53469903-53469925 CACCCTTCAGGGAGGGAACTGGG + Intergenic
1117746746 14:58877288-58877310 CTGGCTGCAAAGAAAGAACTAGG + Intergenic
1118472295 14:66085779-66085801 CAGCATGCAAAGAGAGAAAAAGG + Intergenic
1118513547 14:66503084-66503106 CAGCAGGCAAAGAGGGAATGAGG - Intergenic
1119027401 14:71165127-71165149 CATTCTGCAAAGAGGTTACTGGG - Intergenic
1119313381 14:73669728-73669750 GAGCCTGTAAAGAGGTAATTGGG - Intronic
1120782052 14:88494184-88494206 CAGGCTGCAATGAGGGAGCAAGG + Intronic
1120855795 14:89211525-89211547 CAGGCTACAAAGAGGGATCTGGG + Intronic
1120959518 14:90111737-90111759 CTGCCTGCACAGAGGGAAAGTGG - Intronic
1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG + Intronic
1123490372 15:20775540-20775562 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1123546873 15:21344627-21344649 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1125545568 15:40501731-40501753 CAATCAGCAAAGAGAGAACTTGG + Intergenic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1128634354 15:69293696-69293718 CTGCTTGCAAAGGGAGAACTGGG - Intergenic
1128771594 15:70286718-70286740 CAGCCTCTACAGAGGGCACTTGG + Intergenic
1130084074 15:80762661-80762683 CAGCAGGCAAAGAGAGAGCTTGG + Intergenic
1130968473 15:88714644-88714666 CAGCCCTCTAAGAGGGACCTGGG + Intergenic
1133103374 16:3492500-3492522 CATCCTGCCCAGAGGGACCTGGG + Intergenic
1133375229 16:5280645-5280667 CAGCCTACCAAGATTGAACTAGG - Intergenic
1133997478 16:10759334-10759356 CATCCTGCAGAGAGGGGACATGG + Intronic
1134238823 16:12488860-12488882 CAGCCTGAAATGAGTGAAGTGGG - Intronic
1134845908 16:17440109-17440131 CAGCCAGCAAGGAAGGAACTGGG + Intronic
1137489394 16:48919006-48919028 CAGACTGCAAGGAGGGAATGTGG - Intergenic
1137901972 16:52278441-52278463 CACCCTGCAAAGAGGGTATGGGG + Intergenic
1138165889 16:54801257-54801279 CTGCCTGCAAAGAGAGAAGAAGG - Intergenic
1139298769 16:65926044-65926066 CAGACAGCAATGAGGGACCTTGG - Intergenic
1141169109 16:81680145-81680167 CAGCCTGCAGGGAGGCCACTCGG + Intronic
1141207307 16:81942787-81942809 CAGCCTGCAGAGGAGGAACACGG - Intronic
1141678555 16:85530615-85530637 CAGCCTGCAACGAGGGCCCAGGG + Intergenic
1141851060 16:86646379-86646401 CTGCCTGGAAAGAAGGGACTTGG - Intergenic
1142029565 16:87831801-87831823 CCGCCTGCAGAGAGGGAACTAGG - Exonic
1142985053 17:3690485-3690507 CTGCCTGCGGAGAGAGAACTTGG - Exonic
1143257007 17:5565892-5565914 CAGCCTACCAAGACTGAACTAGG - Intronic
1143492544 17:7292829-7292851 CAGCCTGCTAAGAGGGAACTAGG + Intronic
1144824807 17:18099905-18099927 CAGCCAGCACAGAGGTATCTTGG + Intronic
1148872207 17:50665155-50665177 CAGCCAGGACAGAGGGACCTAGG - Exonic
1149342111 17:55697982-55698004 CAACCTGCAAGGATGGAAGTGGG - Intergenic
1149614252 17:57985426-57985448 AAGCCTTCTAAGGGGGAACTGGG + Intronic
1150531708 17:65990562-65990584 CTGCCTGCAGAGAGGGCACCTGG + Intronic
1150957718 17:69879297-69879319 CAGCCAGCAAAGATGGAGTTTGG + Intergenic
1150970775 17:70025102-70025124 CTGCCTGCAAAGGGGGAGGTTGG - Intergenic
1151237812 17:72734321-72734343 CAGGCTGCAGAGAAGGAACGAGG - Intronic
1152599049 17:81252350-81252372 CAGCCTGCAAAGGAGGACCTGGG - Exonic
1152599195 17:81253009-81253031 CAGCCTGCAAAGGAGGACCCGGG + Intronic
1153214951 18:2810800-2810822 CAGCAGGCAAAGAGAGAACGAGG + Intergenic
1154447979 18:14450297-14450319 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1155610554 18:27662576-27662598 CAGGCTGCAAACAAAGAACTGGG + Intergenic
1156136951 18:34052942-34052964 CAGACAGCTAAGAGAGAACTAGG + Intronic
1156445756 18:37235645-37235667 CACCCTGGAATGAGGGAGCTTGG - Intergenic
1156931175 18:42645647-42645669 TAGGCTGCAAAGAAAGAACTGGG - Intergenic
1156955316 18:42955836-42955858 GAGCTTGGAAAGAGGGAACAAGG - Intronic
1160949536 19:1658794-1658816 GAGCCTGCAAAGCTGGAACAGGG + Intergenic
1161102528 19:2428321-2428343 CAACCTGCAAAAACGGAGCTGGG - Exonic
1163954006 19:20617261-20617283 CAGCCTCCAAAGAGAGAATCTGG - Intronic
1164033338 19:21431464-21431486 CAGCCTCCAAAGAGGGAATCAGG + Intronic
1164163048 19:22642935-22642957 CAGCCTGCAAATAAGTACCTTGG - Intronic
1164556692 19:29258531-29258553 GAACCTGCAAAGATGGAAATGGG - Intergenic
1165092429 19:33394131-33394153 CAGCCTGCAAAGTTGGCACATGG + Intronic
1166630194 19:44399973-44399995 AATCCTGCAGAGAGAGAACTGGG + Intronic
1166637266 19:44461463-44461485 AATCCTGCAGAGAGAGAACTGGG - Intergenic
1167483780 19:49748308-49748330 CAGGCTCCAAGAAGGGAACTTGG + Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1168267282 19:55229853-55229875 CAGCCTGGGAGGAGGGAGCTGGG + Exonic
925280926 2:2683835-2683857 CAGCCTGCACAGTGGTAAGTGGG - Intergenic
925894629 2:8461784-8461806 GAGCCTGGATAGAGGGAGCTGGG + Intergenic
926308812 2:11659755-11659777 CAGCCTGGGAAGAGGGAGCACGG - Intronic
928490866 2:31781646-31781668 CAGCCTCCCAAGACTGAACTTGG + Intergenic
928865732 2:35915761-35915783 CACACTGCAGAGAGGGAATTAGG - Intergenic
929540990 2:42821087-42821109 CAACCTACAAAGAGTGAACCAGG - Intergenic
930145956 2:48004578-48004600 ATGCGTGCACAGAGGGAACTAGG + Intergenic
931253918 2:60554413-60554435 CGGCCTGGAAAGAGGGGACCGGG + Intergenic
931984019 2:67724216-67724238 CAGTCTGCAAAGAGAGAAAAAGG + Intergenic
932854674 2:75220662-75220684 CAGCAGGCAAAGAGAGAACGAGG - Intergenic
934163351 2:89272725-89272747 GAGCCTGCTAGGAGGTAACTAGG - Intergenic
934203923 2:89909799-89909821 GAGCCTGCTAGGAGGTAACTAGG + Intergenic
936114547 2:109691565-109691587 CAGCCTCCAAAAAGGGGACTTGG + Intergenic
937815072 2:126242410-126242432 CAGACTACAAAGAGGAAAGTTGG - Intergenic
938543568 2:132306531-132306553 AATCCTGCAGAGAGAGAACTGGG - Intergenic
941632379 2:167898759-167898781 TTGCCTGCAAAGAGGGTACACGG - Intergenic
941660621 2:168192225-168192247 CAGCAGGCAAAGAAGGAACATGG + Intronic
942947673 2:181687329-181687351 CAGCCCTCCCAGAGGGAACTGGG + Intergenic
943629222 2:190232359-190232381 CAGACTGCCAAAAGGGAAGTAGG - Intronic
944386197 2:199167689-199167711 CAGCTTGCAGAGAGGGTTCTGGG - Intergenic
946026500 2:216674841-216674863 CAGCCTGCAATGAGGGACTGAGG - Exonic
947368233 2:229418291-229418313 CAGCCTGCAAGGAAGGCAGTTGG + Intronic
947668655 2:231923134-231923156 CAGCATGCACAGAGGGGACCTGG + Intronic
948516631 2:238508090-238508112 CAGCCAGCAGAGAGGGAAGCTGG - Intergenic
948585455 2:239016148-239016170 CAGCCTGCAAAGGAGGACCCTGG + Intergenic
1168887909 20:1272964-1272986 CAGCTTCAGAAGAGGGAACTTGG + Intronic
1168911550 20:1451950-1451972 CAGCCTGCAAAGGGGCAGCAAGG + Intronic
1170864765 20:20143384-20143406 CTCCCAGCAAAGAGGGGACTCGG + Intronic
1171228053 20:23457788-23457810 CACACTTCAAAAAGGGAACTTGG - Intergenic
1171872432 20:30539236-30539258 AATCCTGCAGAGAGAGAACTGGG - Intergenic
1173149696 20:40556148-40556170 CACCCTCCAAAGACTGAACTAGG + Intergenic
1173254077 20:41381008-41381030 AAGGCTCCAAAGAGAGAACTTGG - Intergenic
1174501120 20:50985453-50985475 CAGACTGCCAAAAAGGAACTAGG - Intergenic
1174666508 20:52262936-52262958 CAGCAGGCAAAGGGAGAACTTGG + Intergenic
1175462613 20:59163985-59164007 CTGCCTGCAGAGTAGGAACTGGG + Intergenic
1178441259 21:32600413-32600435 CATCCTGCAAAGAGGAACCCTGG - Intronic
1180013885 21:45070374-45070396 CAGCCTGAAGAGAGAAAACTGGG - Intergenic
1180031507 21:45211805-45211827 CAGCCTGCAAAGAGGGAACTAGG - Intronic
1180061442 21:45387182-45387204 CAGCCTGCAGAGACGGCCCTGGG + Intergenic
1182028432 22:27138307-27138329 CAGGCTGCAGAGAGGGGCCTCGG - Intergenic
1183512374 22:38243697-38243719 CAGCCTGCGAGGAGGGAGCATGG + Intronic
1184516770 22:44966962-44966984 CAACCTGCACACAGGGGACTTGG - Intronic
949984950 3:9533193-9533215 CAGCCTGAAAAGAGGGGTCTGGG - Intronic
950064834 3:10103683-10103705 CAGCCTGGCAAGAAAGAACTTGG - Intronic
952032831 3:29165021-29165043 CCGTCAGCAAGGAGGGAACTTGG - Intergenic
952999109 3:38915185-38915207 CACCCTGCCAAGACTGAACTGGG - Intronic
953457706 3:43055840-43055862 CTGCCTGCCAAGAGTGAGCTGGG - Intronic
953732474 3:45462161-45462183 CAGGCTGCCAAGACTGAACTGGG + Intronic
955150355 3:56360949-56360971 CAGCCAGAAAAGAGGGAAATGGG + Intronic
955489050 3:59464204-59464226 TAGCCTGCAAGGAGGGACCTGGG - Intergenic
956593957 3:70946358-70946380 CAGCTTGATCAGAGGGAACTTGG - Intergenic
957066834 3:75530558-75530580 CAGCCTACCAAGATTGAACTAGG + Intergenic
957757857 3:84513716-84513738 CAGCCTCCAAAGATTGAACCAGG - Intergenic
958103495 3:89044631-89044653 CTGCCAGCTAAGAGGGAACATGG - Intergenic
960281284 3:115784167-115784189 CGGCCTGCAGAGAGGGAGCGCGG - Intergenic
961286313 3:125807492-125807514 CAGCCTACCAAGATTGAACTAGG - Intergenic
961900448 3:130205453-130205475 CAGCCTACCAAGATTGAACTAGG + Intergenic
964166588 3:153714080-153714102 TAGCCAGCAAACAGGAAACTGGG - Intergenic
964629220 3:158791559-158791581 CAGTCTGAAAAGAATGAACTCGG + Intronic
964782202 3:160352540-160352562 CAGCCTGCATAAAGACAACTAGG + Intronic
965257788 3:166438598-166438620 CTGCCAGCAAAGATGTAACTTGG + Intergenic
967107101 3:186262810-186262832 TAGTCTGCAAAGAAGGAAGTGGG - Intronic
967754834 3:193157136-193157158 AAGCCTTCCAAGGGGGAACTGGG + Intergenic
968538310 4:1149057-1149079 TAGCCTGCAAAGAGAAATCTGGG + Intergenic
968943264 4:3650329-3650351 CAGCCTGGAAAGTGGCAATTAGG - Intergenic
969011430 4:4066630-4066652 CAGCCTACCAAGATTGAACTAGG + Intergenic
969243192 4:5915433-5915455 GAGCTTGGAAAGAGGGACCTTGG + Intronic
971734383 4:30427450-30427472 CAGAAGGCAAAGAGGGAACAAGG + Intergenic
971893980 4:32565693-32565715 CAGTCTGCAAAGATGGCACTAGG - Intergenic
972904927 4:43733802-43733824 CAACCTACAAAGACTGAACTAGG + Intergenic
974053123 4:56959888-56959910 AAGCCAGCAAAGGGTGAACTGGG - Intergenic
976515822 4:85965227-85965249 CAGCAGGCAAAGAGAGAGCTTGG + Intronic
977301408 4:95271843-95271865 CAGTCAGGAAAGAGGGAACGAGG - Intronic
981678108 4:147362907-147362929 CAGCAAGCAAAGAGGGAGATGGG + Intergenic
985326656 4:188778135-188778157 CATTTTGCAAAGAGGGAACATGG + Intergenic
987015930 5:13819524-13819546 CATCCAGCAAAGAGGTACCTGGG - Intronic
987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG + Intergenic
987693568 5:21299632-21299654 CAGCCAGCAAGGAAGGACCTGGG - Intergenic
991456041 5:66805765-66805787 CAGCCTGCGAAGCTGGACCTGGG + Intronic
991746698 5:69749914-69749936 CAGCCAGCAAGGAAGGACCTGGG + Intergenic
991751007 5:69805328-69805350 CAGCCAGCAAGGAAGGACCTGGG - Intergenic
991798300 5:70329857-70329879 CAGCCAGCAAGGAAGGACCTGGG + Intergenic
991826076 5:70625226-70625248 CAGCCAGCAAGGAAGGACCTGGG + Intergenic
991830294 5:70680223-70680245 CAGCCAGCAAGGAAGGACCTGGG - Intergenic
991890635 5:71329173-71329195 CAGCCAGCAAGGAAGGACCTGGG + Intergenic
992377122 5:76198959-76198981 GAGCCTGAAAAGAGGGCACAAGG + Intronic
992502803 5:77358381-77358403 TACCCTGCAAAGAGGGAGCAGGG + Intronic
992759257 5:79937048-79937070 CACCCAGCAAAGAGGGAAGGCGG + Intergenic
993446699 5:88021327-88021349 CAGCCTGCAGGGAGGAAACGGGG + Intergenic
995023839 5:107396905-107396927 AATCCTGCAGAGAGGAAACTAGG + Intronic
995652445 5:114385149-114385171 CAGGCAGCAAAGAGAGAAATTGG - Intronic
996686098 5:126282639-126282661 CAGATTGAAAAGAGGGACCTTGG + Intergenic
997352928 5:133243961-133243983 CAGCCTGCACAGCGGCCACTCGG - Intronic
997516544 5:134493864-134493886 CAGCCTCTAAAGAGGGAAATGGG + Intergenic
1002103182 5:176867402-176867424 CAGCCAGCAGAGGGGGAGCTGGG - Intronic
1002199462 5:177519473-177519495 CATCTTGCAAAGAGGGAAACAGG + Intergenic
1005272941 6:24185760-24185782 CAGTCTGCAAAGAAGGAAAAGGG + Intronic
1007234425 6:40380026-40380048 CATCCTTCAAAGGGGGAAGTGGG - Intergenic
1007289568 6:40775214-40775236 CTGGGAGCAAAGAGGGAACTTGG - Intergenic
1009494966 6:64334858-64334880 CATCCTCCAAAGAGTGAACTTGG - Intronic
1012494280 6:99817222-99817244 CAGCATGGAAAGAGGGAAAAAGG - Intergenic
1012499710 6:99875131-99875153 GAGGCTGCAATGAGGGAAGTGGG + Intergenic
1014133365 6:117860381-117860403 CAGCCTCCCAAGATGGAACCAGG + Intergenic
1015811982 6:137169957-137169979 CGTCCTCCAAAGAGTGAACTCGG - Intronic
1016913613 6:149223981-149224003 CTGGCTGCAAAGAGGTTACTAGG - Intronic
1019885488 7:3900746-3900768 GAGCATGCAAAGAGGGAAAGAGG - Intronic
1019959378 7:4446227-4446249 CACCTTGAAAAGAGGGCACTGGG - Intergenic
1021624545 7:22579839-22579861 CAGCATGCAAAGAGAGAATGAGG + Intronic
1022237087 7:28472762-28472784 CAGGCTGCAGAGAGAGACCTTGG - Intronic
1022519035 7:30994235-30994257 GACCCTGCGAAGAGGGAACGGGG + Intergenic
1022802861 7:33792505-33792527 CAGGCTACAAAGCGGAAACTGGG - Intergenic
1027681277 7:81223980-81224002 CAGCAGGCAAAGAGAGAACTTGG - Intergenic
1029070723 7:97894652-97894674 CAGCCTACCAAGATTGAACTAGG + Intergenic
1029159398 7:98540995-98541017 CATCCTGCAAAGTGGGAACCAGG - Intergenic
1029600126 7:101558524-101558546 CAGCTTGCAAAGGGGACACTGGG - Exonic
1029939292 7:104462953-104462975 CACCCTCCAAAGACTGAACTGGG - Intronic
1030407959 7:109138691-109138713 CAGCCTACCAAGATGGAACCAGG - Intergenic
1031669561 7:124526093-124526115 CAGAGGGCAAAGATGGAACTGGG - Intergenic
1034857241 7:154563322-154563344 CAGAGAGCTAAGAGGGAACTAGG + Intronic
1036247845 8:7135124-7135146 CAGCCTACCAAGATTGAACTAGG - Intergenic
1036252968 8:7179249-7179271 CAGCCTACCAAGATTGAACTAGG + Intergenic
1036364528 8:8108225-8108247 CAGCCTACCAAGATTGAACTAGG - Intergenic
1036762367 8:11518169-11518191 CAGCCTGCACAGAGTGGCCTTGG + Intronic
1036894017 8:12616980-12617002 CAGCCTACCAAGATTGAACTAGG + Intergenic
1039724860 8:40205076-40205098 CAGCAAGTAAAGAGGGCACTGGG + Intergenic
1047415150 8:124658618-124658640 CAGAATGCAAAGAGGGAGCTAGG + Intronic
1050162654 9:2734358-2734380 CAGCCTGGGAGGAGGGAACTGGG - Intronic
1051398529 9:16654047-16654069 CAGTCTGCACAGAGTGATCTGGG + Intronic
1052043588 9:23768996-23769018 CAGCCTAAACAGAGTGAACTTGG + Intronic
1052059789 9:23946084-23946106 CAGCCAGCCAAGCGGGGACTTGG + Intergenic
1052473627 9:28930813-28930835 TAGCCTGGTAAAAGGGAACTGGG - Intergenic
1053490053 9:38492481-38492503 CAGCCTCCCAAGACTGAACTAGG + Intergenic
1055175436 9:73313020-73313042 CAGCAGGCAAAGAGAGAGCTTGG + Intergenic
1055176620 9:73325754-73325776 AAGCCTGGTAAGAGGGAAGTAGG + Intergenic
1055999227 9:82196207-82196229 CAGCCTGTAATGAGAGACCTTGG + Intergenic
1056197636 9:84243931-84243953 CATTTTACAAAGAGGGAACTGGG - Intergenic
1057708262 9:97412902-97412924 CAGCTTGCTAGGAGGGAGCTTGG + Intronic
1057828268 9:98387849-98387871 CTGCTTGCAAAGAAGGAATTTGG - Intronic
1058142217 9:101369016-101369038 CAGCCTGCAAAAAATGAACATGG - Intronic
1061831906 9:133301545-133301567 CAGCCTGCATAGAGGACACTGGG - Intergenic
1061939539 9:133876631-133876653 CAGGCTGCAAAGAGGATACTGGG + Intronic
1203490563 Un_GL000224v1:101007-101029 CAGCCTCCAAAGAGGGAATCTGG - Intergenic
1203503186 Un_KI270741v1:42886-42908 CAGCCTCCAAAGAGGGAATCTGG - Intergenic
1190027653 X:46940533-46940555 AAGCCTGCAGAAAGGCAACTAGG - Intronic
1190258486 X:48783019-48783041 CAGCCAGCAAGGAGGCAGCTGGG - Intergenic
1194252156 X:91589230-91589252 CACCCTCCAAAGATGGAACCAGG + Intergenic
1194364547 X:92997235-92997257 CAGCAGGCAAAGAGAGAGCTTGG - Intergenic
1194895936 X:99439843-99439865 CAGCCTGCCAAGATTGAACCAGG + Intergenic
1195859265 X:109363798-109363820 CGGCATGCAGAGAGGGAACAAGG - Intergenic
1195903242 X:109819873-109819895 TAGCCTACAAAGAGGGTATTGGG - Intergenic
1196967476 X:121073402-121073424 CAACCTACCAAGAGTGAACTAGG - Intergenic
1197589824 X:128394570-128394592 GAGCCTACATGGAGGGAACTAGG - Intergenic
1200571087 Y:4830469-4830491 CACCCTCCAAAGATGGAACCAGG + Intergenic
1200672772 Y:6113500-6113522 CAGCAGGCAAAGAGAGAGCTTGG - Intergenic