ID: 1180032264

View in Genome Browser
Species Human (GRCh38)
Location 21:45220575-45220597
Sequence CACTTGTCTGACAGGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 385}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180032264_1180032272 24 Left 1180032264 21:45220575-45220597 CCACCTGCCCTGTCAGACAAGTG 0: 1
1: 0
2: 0
3: 25
4: 385
Right 1180032272 21:45220622-45220644 TCTCAGCACTGCTCCTATTCTGG 0: 1
1: 0
2: 0
3: 17
4: 134
1180032264_1180032273 27 Left 1180032264 21:45220575-45220597 CCACCTGCCCTGTCAGACAAGTG 0: 1
1: 0
2: 0
3: 25
4: 385
Right 1180032273 21:45220625-45220647 CAGCACTGCTCCTATTCTGGTGG 0: 1
1: 0
2: 0
3: 12
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180032264 Original CRISPR CACTTGTCTGACAGGGCAGG TGG (reversed) Intronic
901662253 1:10805970-10805992 CTCTTCTCTGGCAGGGCAGTGGG - Intergenic
902212310 1:14912910-14912932 CCCTTCTCTCATAGGGCAGGTGG + Intronic
902393319 1:16118866-16118888 CACTGGGCTGGCAGAGCAGGCGG - Intergenic
902746836 1:18480319-18480341 AACTTGTCAGGCAGGGAAGGAGG + Intergenic
903148023 1:21387747-21387769 CACTTCTCAGACGGGGCAGCCGG - Intergenic
903548635 1:24142632-24142654 CACTGGCCTGACAGGGGAGGAGG - Intronic
904558031 1:31378154-31378176 CACTTAGCTCACAGTGCAGGGGG + Intergenic
904930326 1:34082276-34082298 CACTTCTCAGACGGGGCAGCCGG - Intronic
906778259 1:48549307-48549329 CACTTGTCTGACACTGTGGGAGG - Intronic
910412738 1:86963987-86964009 CACTTCTCAGACAGGGCGGCCGG + Intronic
910891664 1:92026158-92026180 CACTTCTCAGACAGGGCGGCCGG + Intergenic
914887989 1:151600313-151600335 CACTTCTCAGACGGGGCAGCCGG - Intergenic
914909005 1:151769421-151769443 CACTTCTCAGACAGGGCGGACGG + Intronic
914986200 1:152459170-152459192 CCCTTATGTGAAAGGGCAGGTGG - Intergenic
915992653 1:160532320-160532342 CACTTCCCAGACAGGGCAGCCGG - Intergenic
916221779 1:162451577-162451599 CACTTCCCAGACAGGGCAGCCGG + Intergenic
916448580 1:164896640-164896662 AACTTGAAAGACAGGGCAGGAGG + Intronic
917534960 1:175867825-175867847 CCCTGGTGTGTCAGGGCAGGTGG + Intergenic
917703082 1:177600903-177600925 CACTGGTCTGACATGGCATGGGG - Intergenic
918228799 1:182509951-182509973 CACTTCTCAGACAGGGCGGCCGG + Intronic
918818837 1:189225891-189225913 CACTTCTCAGACGGGGCAGCCGG - Intergenic
919140295 1:193562076-193562098 CAGTTGTCTTACATGGCAGGGGG + Intergenic
919423863 1:197405720-197405742 CACTTCTCAGACAGGGCGGCTGG - Intronic
919959463 1:202451978-202452000 CACTTCTCAGACAGGGCGGCCGG + Intronic
920817567 1:209349283-209349305 CACCTGCCATACAGGGCAGGTGG - Intergenic
922041024 1:221897622-221897644 CACTTGTATTGCAGGGCAGAAGG + Intergenic
922669392 1:227497363-227497385 CACTTCTCTTACATGGCAGCAGG - Intergenic
922670201 1:227503939-227503961 CACTTCTCTTACATGGCAGCAGG + Intergenic
923174881 1:231454276-231454298 CACTTCTCAGACGGGGCAGCCGG - Intergenic
924943695 1:248830297-248830319 CACTTCTCAGACAGGGCATTCGG - Intergenic
1062960562 10:1570620-1570642 CACTGCTGTGACAGGCCAGGGGG - Intronic
1063310092 10:4944214-4944236 CACTTGGCTGGCAGGAGAGGGGG - Intronic
1063744936 10:8869143-8869165 CACTTCTCAGACAGGGCGGCCGG - Intergenic
1064663623 10:17629391-17629413 CACTTCTCAGACGGGGCAGCCGG + Intergenic
1066818732 10:39456048-39456070 CACTTCCCAGACAGGGCAGCCGG + Intergenic
1067339753 10:45391778-45391800 CACTTCTCAGACAGGGCGGCCGG - Intronic
1067382330 10:45786412-45786434 CACTTATGTGACAGAGGAGGAGG + Intronic
1067872030 10:49970476-49970498 CACTTCTCAGACAGGGCGGCTGG - Intronic
1068255125 10:54499463-54499485 CTATTGTCTGAGAGGGCAGTTGG - Intronic
1069338448 10:67381805-67381827 CACCTGTCAGAAAGGGCTGGAGG - Intronic
1069424811 10:68279573-68279595 CACTTCTCAGACAGGGCGGCCGG - Intergenic
1070105480 10:73426881-73426903 CATTTGGCAGACAAGGCAGGAGG + Intronic
1070367375 10:75750350-75750372 CACTTCTCAGACGGGGCAGCAGG + Intronic
1070629694 10:78076016-78076038 CACTTCTCAGACGGGGCAGCCGG + Intergenic
1070684163 10:78468956-78468978 CACTTCTCAGACAGGGCGGCCGG + Intergenic
1070755816 10:78992650-78992672 CGCTTCTCTCACAGGGGAGGGGG + Intergenic
1070966430 10:80534032-80534054 CACTTCTCAGACGGGGCAGCCGG - Intergenic
1074699423 10:116080065-116080087 CACTTCTCTGACACTGAAGGTGG + Intronic
1076373444 10:129968789-129968811 AACTTGCCTCAGAGGGCAGGCGG - Intergenic
1077066225 11:642116-642138 CACGTGCCTGACAGCGCTGGAGG + Intergenic
1077397523 11:2332470-2332492 CACTTCTCAGACAGGGCGGCCGG - Intergenic
1079020552 11:16906968-16906990 CACTTCTCAGACAGGGCGGCCGG - Intronic
1080097917 11:28430080-28430102 CACTTCTCAGACAGGGCGGCCGG - Intergenic
1080591816 11:33730895-33730917 TACTTGTCTGAAATGGCAGGCGG - Intronic
1081080330 11:38732744-38732766 CACTTGTCTTACATGGCAGCAGG + Intergenic
1081288646 11:41303810-41303832 CACTTCTCAGACAGGGCGGCCGG - Intronic
1081858501 11:46318741-46318763 CACGTGTCTGGCAGGACAGGAGG + Intronic
1082166467 11:48955799-48955821 CACTTCTCAGACAGGGCGGCGGG + Intergenic
1082660691 11:55907059-55907081 CACTTCTCAAGCAGGGCAGGAGG + Intergenic
1084166999 11:67379720-67379742 CACTTCTCTGCCAGGGGAGACGG - Intronic
1085767425 11:79295346-79295368 CCCTTGTCTGACATGGGAGGAGG - Intronic
1086520769 11:87665578-87665600 CAAGTGTCTTACATGGCAGGAGG + Intergenic
1086791401 11:91043199-91043221 CACCTTTCTCACAGGGCAGCAGG + Intergenic
1087133646 11:94692882-94692904 CAATTGACTGACAGAGCAGGTGG + Intergenic
1089289992 11:117431792-117431814 CACTTACCAGAAAGGGCAGGGGG + Intronic
1091005988 11:131954233-131954255 CACTCAGCAGACAGGGCAGGAGG + Intronic
1091698013 12:2641025-2641047 CCCTTCTCTGCCATGGCAGGGGG - Intronic
1092331508 12:7590457-7590479 CCCTTCTCAGACAGGGCAGCTGG + Intergenic
1092536650 12:9395253-9395275 CTCTGGTGTGGCAGGGCAGGAGG + Intergenic
1092850005 12:12618303-12618325 CACTTCTCAGACGGGGCAGCCGG + Intronic
1094331836 12:29302442-29302464 CACGTGCCTGGCAGGGCAGCTGG + Intronic
1095439443 12:42227562-42227584 CACTTCTCAGACAGGGCGGCCGG - Intronic
1096039441 12:48500782-48500804 CACTTCTCAGACAGGGCGGCCGG + Intergenic
1096406077 12:51345335-51345357 CACTTTGCTAACAGGGCAGCTGG - Intronic
1096951643 12:55479349-55479371 CACTTCTCAGACAGGGCGGCCGG + Intergenic
1097127130 12:56783949-56783971 CACTTCTCAGACGGGGCAGCCGG + Intronic
1097254772 12:57665151-57665173 CACTTCCCAGACAGGGCAGCTGG - Intergenic
1097905273 12:64913036-64913058 CACTTTTCTGCCAGAGCAGCGGG + Intergenic
1098136249 12:67405502-67405524 CTCTTGTAAGGCAGGGCAGGTGG - Intergenic
1099505470 12:83470901-83470923 CAGATGTCTGAGTGGGCAGGAGG - Intergenic
1101198447 12:102409565-102409587 CACTTGTATGAGATGGCAGGGGG - Intronic
1101516586 12:105441352-105441374 CACTTGGATCACAAGGCAGGTGG - Intergenic
1102294186 12:111723859-111723881 CACTTCTCAGACAGGGCGGCCGG + Intronic
1104861465 12:131926456-131926478 CACTTCTCAGACGGGGCAGCCGG + Intergenic
1105236562 13:18561256-18561278 CACATGTCTGACACCTCAGGTGG + Intergenic
1105921809 13:24970537-24970559 CACTTCTCAGACGGGGCAGCGGG + Intergenic
1107498822 13:40955091-40955113 CACTTCTCAGACGGGGCAGCCGG - Intronic
1107737741 13:43416562-43416584 CACTTCCCAGACAGGGCAGCCGG + Intronic
1110484521 13:76022380-76022402 CATCTATCTGACAGTGCAGGGGG - Intergenic
1112077287 13:95928467-95928489 CACTTCTCAGACGGGGCAGCCGG + Intronic
1113876764 13:113599612-113599634 CACTGATCCAACAGGGCAGGGGG - Intronic
1114427647 14:22637135-22637157 CACTTCTCAGACAGGGCGGCCGG - Intergenic
1114507875 14:23232326-23232348 CACTTCTCAGACAGGGCAGCCGG - Intronic
1115500743 14:34047294-34047316 CACTTCTTTGTCAGGGCAAGTGG - Intronic
1115979529 14:39034855-39034877 CACTTCTGTGACAGTGCTGGAGG - Intronic
1116409092 14:44601423-44601445 CACTTCTCAGACGGGGCAGCCGG - Intergenic
1116959661 14:50956619-50956641 CACTTCTCAGACAGGGCGGCCGG + Intergenic
1118095505 14:62532771-62532793 CACATGGCTGAACGGGCAGGTGG + Intergenic
1118925225 14:70185893-70185915 CACATGCCTGACAGAGTAGGTGG + Intronic
1118936333 14:70292232-70292254 CACTGGTCTGGCAGATCAGGAGG - Intergenic
1120473112 14:84951629-84951651 CACTTTCCTCACAGGGCAGCAGG - Intergenic
1120589873 14:86363190-86363212 GACTTGTCTTACATGGCAGTAGG + Intergenic
1122238196 14:100344806-100344828 CACTTCTCAGACAGGGCGGCCGG - Intronic
1122792215 14:104188826-104188848 CACCTCTCTGCCAAGGCAGGAGG + Intergenic
1122937878 14:104968233-104968255 CCCTTGCATGCCAGGGCAGGTGG + Intronic
1122947435 14:105019212-105019234 GACATGTCCGACATGGCAGGTGG + Intronic
1202833621 14_GL000009v2_random:61454-61476 CAATTGTCTCACATGGCAAGGGG - Intergenic
1123429712 15:20204093-20204115 CACTTCTCAGACAGGGCGGCCGG + Intergenic
1124715505 15:32057048-32057070 CACTTGTCTTACTTGGCATGGGG + Intronic
1125482904 15:40092833-40092855 TCTTTGTCTGCCAGGGCAGGAGG + Intronic
1129008722 15:72396578-72396600 CACTTCTCAGACAGGGCAGCTGG - Intergenic
1129167529 15:73787238-73787260 CACTGGACTCACAGGGCTGGTGG + Intergenic
1129453491 15:75663626-75663648 TACTTGTCATCCAGGGCAGGAGG + Intergenic
1129664944 15:77574317-77574339 CTCTTTTCTGACAGGGCATGAGG + Intergenic
1129739096 15:77981368-77981390 CCCTTGGCTGACAGGGTATGTGG + Intergenic
1129846862 15:78771821-78771843 CCCTTGGCTGACAGGGTATGTGG - Exonic
1130255038 15:82322070-82322092 CCCTTGCCTGACAGGGTATGTGG + Intergenic
1130599936 15:85267936-85267958 CCCTTGCCTGACAGGGTATGTGG - Intergenic
1130946750 15:88553752-88553774 CACTTCTCAGACGGGGCAGCCGG + Intergenic
1131127149 15:89867735-89867757 CACTTCTCAGACAGGGCGGCCGG - Intronic
1131155776 15:90074351-90074373 CACTCCTCTAACTGGGCAGGAGG - Intronic
1131350211 15:91692773-91692795 CGCGTGTCTGACAGGGGTGGAGG - Intergenic
1132036997 15:98493119-98493141 CACTTCTCAGACAGGGCGGCCGG + Intronic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1133833914 16:9350409-9350431 CACTTCCCAGACAGGGCAGCTGG + Intergenic
1133833947 16:9350519-9350541 CACTTCCCAGACAGGGCAGCTGG + Intergenic
1135694440 16:24574607-24574629 CACTTCTCAGACGGGGCAGCCGG + Intergenic
1135846636 16:25924847-25924869 CCCTGGTCTGGCAGGGCAGCAGG + Intronic
1137283851 16:47000181-47000203 CACTTCTCAGACGGGGCAGCCGG - Intergenic
1137626137 16:49910004-49910026 CACATGTTTGACTGGGCTGGAGG - Intergenic
1138861764 16:60766576-60766598 CCCTTGTGTGTGAGGGCAGGGGG + Intergenic
1139394729 16:66630981-66631003 CACTTCTCAGACGGGGCAGCTGG - Intronic
1139623236 16:68163674-68163696 CACTTCTCTGACGGGGCGGCCGG + Intronic
1141105326 16:81228841-81228863 CACTTGTCCCACAGGACGGGTGG - Intergenic
1142151744 16:88515560-88515582 CCCCTGTCTGCCAGGGCAGCTGG + Intronic
1142863893 17:2778937-2778959 CCCTTGTCTGGCAGGGGATGGGG - Intronic
1142962447 17:3559200-3559222 AACTTTTCTCAGAGGGCAGGTGG + Intergenic
1143008821 17:3854373-3854395 CACTTCTCAGACAGGGCGGCCGG - Intergenic
1143110865 17:4552075-4552097 CACTTCACGGACAGGGAAGGGGG + Intronic
1146634846 17:34496313-34496335 CACTTGGCAGACAGGCTAGGAGG + Intergenic
1147277885 17:39333868-39333890 CACTTCTCAGACGGGGCAGCCGG - Intronic
1147362691 17:39941602-39941624 CACCTCTCTGACCTGGCAGGAGG + Intronic
1148672143 17:49419418-49419440 CACTTCCCAGACAGGGCAGCCGG + Intronic
1151373697 17:73667697-73667719 CATGTGTCAGACAGGGCATGAGG + Intergenic
1154278697 18:12981093-12981115 CACTTCTCAGACAGGGCGGCCGG + Intronic
1154398351 18:14011123-14011145 CACTTCTCAGACGGGGCAGCCGG + Intergenic
1154420316 18:14223197-14223219 CACTTCCCAGACAGGGCAGCTGG - Intergenic
1154423553 18:14254885-14254907 CAGTTGTCTCACATGGCAAGGGG - Intergenic
1154512972 18:15128660-15128682 CACATGTCTGACACCTCAGGTGG - Intergenic
1157677459 18:49578295-49578317 CACTTCTCAGACGGGGCAGCCGG + Intronic
1159475905 18:68920709-68920731 CACCTTTCTCACAGGGCAGCAGG + Intronic
1159884986 18:73895309-73895331 CACTTGGTGGGCAGGGCAGGGGG + Intergenic
1161255455 19:3306582-3306604 CACTTTTCTGACCGGGGAGAAGG - Intergenic
1161844882 19:6706922-6706944 CCCCTGTCTGAGGGGGCAGGAGG - Intronic
1162163840 19:8739421-8739443 CACTTCTCAGACAGGGCAGCCGG - Intergenic
1162514209 19:11138498-11138520 CACTTGTCCTGCAGGGCTGGGGG + Intronic
1164016457 19:21259715-21259737 CACTTCCCAGACAGGGCAGCCGG + Intronic
1164040242 19:21487126-21487148 CACTTCTCAGACAGGGCGGCCGG + Intronic
1164218626 19:23173208-23173230 CACTTCTCACACAGGGCAGCCGG - Intergenic
1164803278 19:31095824-31095846 GACTTGTCTGTCAGGCCAGCTGG + Intergenic
1165438222 19:35808504-35808526 CAATCCTCTGACAGGGGAGGAGG - Intronic
1165768334 19:38364274-38364296 CACTTCTCAGACAGGGCGGCTGG + Intronic
1202639046 1_KI270706v1_random:66238-66260 CAATTGTCTCACATGGCAAGGGG + Intergenic
925299341 2:2799449-2799471 CACACATGTGACAGGGCAGGTGG + Intergenic
925395403 2:3529890-3529912 CAGTGGACTGACAGGGCTGGAGG - Intergenic
926475635 2:13318509-13318531 AACTTGTCTGGCAGGGAAGCTGG - Intergenic
926907336 2:17817765-17817787 AGCTTGTGTGACAGGGAAGGAGG + Intergenic
927207757 2:20620872-20620894 CCCCTGTCTGACTGGGCTGGGGG - Intronic
927511989 2:23649687-23649709 CAGTTGTCTGACAGGGCCAGAGG + Intronic
927757833 2:25723346-25723368 CACCTGCCGGACAGGGCAGCTGG + Intergenic
927757873 2:25723475-25723497 CACTTCTCAGACGGGGCAGCCGG + Intergenic
927875042 2:26649722-26649744 CACTTGGCAGTCAGGGCAGCTGG - Intergenic
928535629 2:32238233-32238255 CACTTGTCTGACATTGGAGAGGG - Exonic
928542214 2:32294339-32294361 CACTTCTCAGACAGGGCGGCTGG + Intronic
929238336 2:39628462-39628484 CACTTCTCAGACGGGGCAGCCGG + Intergenic
929517967 2:42621910-42621932 CACTTCTCAGACTGGGCAGCCGG + Intronic
929574709 2:43044238-43044260 CCCCTTTGTGACAGGGCAGGAGG + Intergenic
930752337 2:54945696-54945718 CACTGGGCTGACAGAGCAAGAGG - Intronic
931972310 2:67602272-67602294 CACCTGGCTGTCAGTGCAGGAGG - Intergenic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
934703430 2:96461515-96461537 CACTTCTCAGACGGGGCAGCCGG - Intergenic
936172191 2:110186027-110186049 CATTAGTGTGGCAGGGCAGGAGG - Intronic
937305187 2:120866637-120866659 CACCTGGCAGACAGGGCGGGTGG + Intronic
938513226 2:131973299-131973321 CACATGTCTGACACCTCAGGTGG - Intergenic
938741332 2:134235247-134235269 CACTTATCTGCCTGGGAAGGTGG + Intronic
942024685 2:171899962-171899984 CACTTCTCAGACGGGGCAGCCGG - Intronic
942113635 2:172706813-172706835 TACCTCTTTGACAGGGCAGGTGG + Intergenic
942708055 2:178799513-178799535 CACGTGTCTGACCGGGGAAGGGG + Exonic
943051248 2:182915985-182916007 CACTTGTCTGGGATGTCAGGGGG - Intronic
943125732 2:183792206-183792228 CACTTCCCAGACAGGGCAGCTGG + Intergenic
943570693 2:189570848-189570870 TACTTGTCTGTCAGGACAGTTGG + Intronic
944785679 2:203067065-203067087 CACTTCCCAGACAGGGCAGCCGG + Intronic
945864843 2:215163532-215163554 CACTTCTCAGACGGGGCAGCCGG + Intergenic
946304173 2:218846623-218846645 CACTTCTCAGACGGGGCAGCCGG - Intergenic
946447363 2:219751268-219751290 CACTTCTCAGACAGGGCGGCCGG + Intergenic
948778129 2:240300552-240300574 CCTTTGACTGACAGGCCAGGCGG + Intergenic
948941574 2:241199577-241199599 CACTGGGCAAACAGGGCAGGTGG + Intronic
949063889 2:241977626-241977648 CTCTTCACTGACAGGGCTGGAGG - Intergenic
1169063274 20:2677006-2677028 CATTTGTCTTGCAGGGAAGGAGG + Intergenic
1169724033 20:8710216-8710238 CAGGTGTCTTACATGGCAGGAGG + Intronic
1170684699 20:18559053-18559075 CACTACTCTGACAGGGAAGGTGG + Intronic
1171861214 20:30404901-30404923 CACTTCTCAGACAGGGCAGCTGG - Intergenic
1171885657 20:30650429-30650451 CAGTTGTCTCACATGGCAAGGGG + Intergenic
1172059033 20:32176055-32176077 CACTTCTCAGACAGGGCGGCCGG - Intergenic
1172306168 20:33882333-33882355 CATTTGTCTGCCATGGCAAGAGG + Intergenic
1172337878 20:34132528-34132550 CACTTCTCAGACGGGGCAGCCGG - Intergenic
1172669454 20:36624846-36624868 CAGTTGACTGACAGGGGAGCAGG + Intronic
1172717777 20:36976967-36976989 CACTTCTCAGACAGGGCGGCCGG + Intergenic
1172918588 20:38461813-38461835 CACTTCTCAGACAGGGCAGCCGG + Intergenic
1173508462 20:43607442-43607464 CACTTCTCAGACAGGGCGGCTGG + Intronic
1173545552 20:43895029-43895051 AAGTTGTCTAAAAGGGCAGGAGG + Intergenic
1175264130 20:57692390-57692412 CAATGGTCTGTCAGGGCTGGTGG + Intronic
1175775924 20:61653657-61653679 CACTTCTCAGACAGGGCGGCCGG + Intronic
1175978384 20:62725093-62725115 CACTTGTCTGCCGGGAGAGGAGG - Intronic
1176780551 21:13189542-13189564 CACATGTCTGACACCTCAGGTGG + Intergenic
1176853026 21:13936305-13936327 CACTTCCCAGACAGGGCAGCCGG + Intergenic
1176853034 21:13936342-13936364 CACTTCCCAGACAGGGCAGCCGG + Intergenic
1177276282 21:18917017-18917039 CACGTGTCTCTCAGGGAAGGAGG + Intergenic
1177978230 21:27878653-27878675 CACATGTCTGACACCTCAGGTGG + Intergenic
1180032264 21:45220575-45220597 CACTTGTCTGACAGGGCAGGTGG - Intronic
1180320958 22:11321002-11321024 CACATCTCTGACATGGCAGCAGG - Intergenic
1180334085 22:11559743-11559765 CACATCTCTGACATGGCAGCAGG + Intergenic
1180362902 22:11915625-11915647 CAATTGTCTCACATGGCAAGGGG - Intergenic
1180724882 22:17939433-17939455 CACCTTTGTGAGAGGGCAGGAGG - Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182241265 22:28918181-28918203 CGCTGGGCTGGCAGGGCAGGGGG - Intronic
1182714169 22:32341510-32341532 CACTGGTCAGCCAGGGGAGGAGG - Intergenic
1183548110 22:38466096-38466118 CACCTCCCTGCCAGGGCAGGAGG + Intergenic
1184164056 22:42717079-42717101 CACTGGTCTGGAAGGGAAGGGGG + Intronic
1184302743 22:43572034-43572056 CACTGATGGGACAGGGCAGGAGG + Intronic
1184345279 22:43909223-43909245 CACTGGACTGCCAGGGGAGGCGG + Intergenic
1185139664 22:49093285-49093307 CACCTGGGTGACAAGGCAGGTGG - Intergenic
949570004 3:5283996-5284018 CACTTCTCAGACGGGGCAGCCGG + Intergenic
949866309 3:8550269-8550291 CACTTGGTTGATGGGGCAGGAGG - Intronic
950044297 3:9940056-9940078 CACTTCTCAGACAGGGCGGCCGG + Intronic
950740427 3:15046742-15046764 CACTTTTCTCCCAGGGAAGGCGG + Exonic
951795290 3:26532172-26532194 CACTTGTATGACAAGTCTGGTGG + Intergenic
952558378 3:34559905-34559927 CAGGTGTCTCACAGGGCAAGAGG + Intergenic
952892610 3:38053473-38053495 CACTTCTCAGACAGGGCGGCTGG - Intronic
953983026 3:47422147-47422169 CACTTGGCTGAAAGGGAAGCAGG + Intronic
954481348 3:50803972-50803994 CACTTCTCAGACAGGGCGGCCGG + Intronic
955072274 3:55581797-55581819 CACTTCTCTTCCAGGACAGGTGG + Intronic
957035447 3:75289469-75289491 CACTTCTCAGACAGGGCGGCCGG - Intergenic
957515776 3:81249164-81249186 AACTTGTCTTACATGGCAGCAGG - Intergenic
958445354 3:94208274-94208296 CACTGAGCTGAAAGGGCAGGAGG - Intergenic
958464127 3:94437743-94437765 CATTTTTCTGAGAGGGTAGGAGG + Intergenic
959359305 3:105368404-105368426 CAGTTGCCTGACAGAGCAGCAGG + Intronic
959419495 3:106112247-106112269 CACTTCTCAGACGGGGCAGCCGG + Intergenic
959932350 3:111998627-111998649 CAACTGTCTGGCAGGACAGGAGG - Intergenic
960526717 3:118718659-118718681 CACTTCTCAGACGGGGCAGCCGG + Intergenic
960866107 3:122201768-122201790 CACTTCTCAGACGGGGCAGCGGG + Intronic
961059482 3:123816363-123816385 CACTTGTCTCAGAGGTCATGAGG + Intronic
961797243 3:129418363-129418385 TACATGACCGACAGGGCAGGGGG + Exonic
963658159 3:148086627-148086649 CCCTTGTTTGACAGGGCAAATGG - Intergenic
966617232 3:181926021-181926043 CACTTCTCAGACGGGGCAGCCGG + Intergenic
967127251 3:186435473-186435495 CACTTCTCAGACGGGGCAGCCGG + Intergenic
967578529 3:191125096-191125118 CACTTCTCAGACGGGGCAGCCGG + Intergenic
968001106 3:195207313-195207335 CACACGTCTGGCTGGGCAGGAGG + Intronic
968042403 3:195599696-195599718 CACTTCCCAGACAGGGCAGCCGG + Intergenic
968547504 4:1206394-1206416 CACTGCTCTGCCAGGGCAGGGGG + Intronic
972270750 4:37509312-37509334 CACTTCTCAGACAGGGCGGCCGG + Intronic
972551790 4:40141359-40141381 CACTTCTCAGACGGGGCAGCCGG + Intronic
972700706 4:41491370-41491392 CACTTCCCCGACAGGGCAGCCGG + Intronic
973675260 4:53256237-53256259 CACTTCTCAGACGGGGCAGCCGG + Intronic
974597878 4:64037400-64037422 CACTTCTCAGACAGGGCGGCCGG - Intergenic
975063884 4:70037880-70037902 CACTTCCCAGACAGGGCAGCTGG - Intergenic
975238254 4:72026362-72026384 CACTTCTCTGAGAGGCCAGAAGG - Intergenic
975633438 4:76423421-76423443 CACTTCTCAGACGGGGCAGCTGG - Intergenic
975795956 4:78007276-78007298 CACTTCTCAGACAGGGCGGCCGG + Intergenic
976265061 4:83182200-83182222 CACTTCTCAGACGGGGCAGCTGG - Intergenic
977205102 4:94157997-94158019 CACTTCTCAGACGGGGCAGCCGG - Intergenic
977748441 4:100579643-100579665 TACTTGGCTAAGAGGGCAGGAGG + Intronic
978014310 4:103723470-103723492 CACTTCCCAGACAGGGCAGCCGG - Intergenic
978224903 4:106321469-106321491 CACTTCTCAGACCGGGCAGCCGG - Exonic
978820272 4:112957867-112957889 CACTTCTCAGACGGGGCAGCCGG + Intronic
979217573 4:118183675-118183697 CACTTGTCTTGCAAGGGAGGTGG - Intronic
979641646 4:123016394-123016416 CACTTCTCAGACAGGGCGGCTGG + Intronic
980883618 4:138739246-138739268 CACTTCTCAGACGGGGCAGCCGG - Intergenic
981677460 4:147357999-147358021 CACTTCTCAGACAGGGCGGCCGG - Intergenic
982820949 4:159939927-159939949 CACTTCTCAGACAGGGCGGCCGG + Intergenic
983652199 4:170046397-170046419 CACTTCTCAGACAGGGCGGCCGG - Intergenic
983664471 4:170166396-170166418 CACTTCTCAGACAGGGCAGCCGG + Intergenic
984787611 4:183583386-183583408 CACTTGTCAGAGAGGGCCAGTGG + Intergenic
985216353 4:187658099-187658121 CACTTCTCAGACAGGGCGGCGGG - Intergenic
1202766397 4_GL000008v2_random:152096-152118 CAATTGTCTCACATGGCAAGGGG + Intergenic
985542613 5:493866-493888 CACCTGTCAGGCAGGGCAGCGGG + Intronic
985683557 5:1269918-1269940 CTCCTGTCTGTCAGGGCATGAGG + Intronic
985736412 5:1586093-1586115 CACTTCTCCGACGGGGCAGCCGG - Intergenic
986244349 5:5991925-5991947 CACCTGTGTGGCATGGCAGGGGG + Intergenic
986480764 5:8184685-8184707 CACTTGGATGAGAGGGCTGGTGG - Intergenic
986932925 5:12850057-12850079 CACCTTTCTTAGAGGGCAGGAGG - Intergenic
987112593 5:14701410-14701432 CCCGAGTTTGACAGGGCAGGGGG - Intergenic
987469276 5:18309689-18309711 CACTTCTCAGACAGGGCGGCCGG - Intergenic
988347977 5:30064799-30064821 CACTAAAGTGACAGGGCAGGTGG + Intergenic
989068183 5:37483867-37483889 CACTTCTCAGACGGGGCAGCTGG + Intronic
989574739 5:42979418-42979440 CACTTCTCTGACGGGGCGGCCGG - Intergenic
989634833 5:43522184-43522206 CACTTCTCAGACGGGGCAGCCGG - Intergenic
989655921 5:43746247-43746269 CACTTCTCAGACGGGGCAGCCGG + Intergenic
989847258 5:46160302-46160324 CTCTTGTAGGACAGGCCAGGTGG + Intergenic
990459114 5:56015245-56015267 CACTTCTCAGACAGGGCGGCTGG + Intergenic
991492399 5:67195837-67195859 CCCTTGTCTGACAGGCCACGTGG + Intronic
991493366 5:67204857-67204879 CTCTTTAATGACAGGGCAGGAGG + Intergenic
992373813 5:76171463-76171485 CACTTCTCAGACGGGGCAGCCGG - Intronic
992491043 5:77244895-77244917 AACTTGTCATCCAGGGCAGGGGG + Intronic
992637465 5:78738790-78738812 GACCTGCCTGACTGGGCAGGAGG - Intronic
993849733 5:92991926-92991948 CACATGTCTGACAGGACAATAGG - Intergenic
993934707 5:93986222-93986244 CACTTCTCAGACCGGGCAGCCGG - Intronic
994517166 5:100785735-100785757 CACTTCTCAGACGGGGCAGCCGG - Intergenic
995123644 5:108559442-108559464 CACTTCTCAGACAGGGCGGCTGG + Intergenic
995161865 5:108992811-108992833 CACTTCTCAGACAGGGCGGCCGG + Intronic
997433507 5:133857883-133857905 CACTTCCCAGACAGGGCAGCCGG + Intergenic
998074428 5:139224560-139224582 CACTTCTCAGACGGGGCAGCTGG - Intronic
999382248 5:151129521-151129543 CACTTGTCTTGCAGGGCCTGGGG - Exonic
999604196 5:153297054-153297076 CACTTCTCAGACAGGGCGGCCGG + Intergenic
1001566025 5:172700123-172700145 TACTTGTCTGCCAGGGAAGAAGG + Intergenic
1002008047 5:176252412-176252434 CACTTCTCAGACAGGGCGGCCGG + Intronic
1002029982 5:176420869-176420891 CATTTGTCTGACAGGGGCGTGGG + Intergenic
1002952725 6:1831265-1831287 CACTTGTCACACATGGCAGATGG - Intronic
1003148720 6:3530765-3530787 GACAGGACTGACAGGGCAGGGGG + Intergenic
1004415006 6:15415960-15415982 CACTTCTCAGACAGGGCGGCTGG + Intronic
1005865316 6:29932708-29932730 CACTTCTCAGACAGGGCGGCCGG - Intergenic
1006065109 6:31455775-31455797 CACTTCTCAGACGGGGCAGCTGG + Intergenic
1006546637 6:34786548-34786570 CACTTCTCAGACAGGGCGGCCGG - Intergenic
1007340406 6:41187804-41187826 GACTTGTCAGTCAGGGGAGGTGG + Intergenic
1007545012 6:42686836-42686858 CACTTCTCAGACGGGGCAGCCGG + Intronic
1007572839 6:42905645-42905667 CACTTGGCTGGCAGGAAAGGAGG - Intergenic
1007674336 6:43581166-43581188 CACTTCTCAGACGGGGCAGCCGG + Intronic
1008571991 6:52825363-52825385 CACTTCCCAGACAGGGCAGCCGG - Intergenic
1009042030 6:58190756-58190778 CACTTCTCAGACAGGGCGGCCGG - Intergenic
1009049013 6:58257614-58257636 CACTTCTCAGACTGGGCAGCCGG - Intergenic
1011148684 6:84244970-84244992 CACTTCTCAGACGGGGCAGCCGG + Intergenic
1011297217 6:85838632-85838654 CACTTCTCAGACGGGGCAGCCGG - Intergenic
1011476124 6:87751356-87751378 CACTTCTCAGACAGGGCGGCCGG + Intergenic
1012014981 6:93838708-93838730 CACTTTCCTCACAGGGCAGCAGG + Intergenic
1013190842 6:107803233-107803255 CACTTCTCAGACAGGGCGGCCGG - Intronic
1013325980 6:109046806-109046828 CACTTCTCAGACAGGGCGGCCGG - Intronic
1015507067 6:133999694-133999716 CACATGTCTCCCTGGGCAGGAGG - Intronic
1016182538 6:141164820-141164842 CACTTGTTTGTAAGGGCAAGAGG + Intergenic
1017107566 6:150902343-150902365 CACTTGTCTGCCTGGGGAGTGGG + Intronic
1017660608 6:156670203-156670225 CACTTCTCAGACAGGGCAGCCGG - Intergenic
1018102529 6:160453909-160453931 GACTTTTCCGACAGGGAAGGAGG - Intergenic
1018752819 6:166822093-166822115 GACAAGACTGACAGGGCAGGGGG - Intronic
1018789968 6:167140741-167140763 CAGTTCTCTGACAGGGAAGTGGG + Intergenic
1019262567 7:89690-89712 CCCTTTTCTCACAGGACAGGAGG + Intergenic
1021350088 7:19581699-19581721 CACTTCTCTGGCAGGGGAAGAGG - Intergenic
1023336226 7:39173779-39173801 ATATTGTCTGACAGGCCAGGAGG - Intronic
1024201797 7:47115864-47115886 CACTTGTCTCACAGAGCTGGTGG + Intergenic
1024538682 7:50459680-50459702 CACTTCTCAGACGGGGCAGCTGG - Intronic
1024931317 7:54668086-54668108 CACTTCTCAGACGGGGCAGCCGG + Intergenic
1025301229 7:57821019-57821041 GCCTTGTCTTACAGGACAGGTGG + Intergenic
1027374010 7:77534169-77534191 CACTTCTCAGACGGGGCAGCCGG + Intergenic
1029691132 7:102182623-102182645 CACTTGTCAGATTAGGCAGGAGG - Intronic
1029990673 7:104960074-104960096 CAAATCTCAGACAGGGCAGGAGG - Intergenic
1032028639 7:128463546-128463568 CACTTCTCAGACGGGGCAGCCGG - Intergenic
1032129485 7:129216493-129216515 CACTTCTCAGACGGGGCAGCTGG - Intergenic
1033277347 7:139982302-139982324 CTCTTCTCTGGCAGGGCAGAGGG + Intronic
1034087320 7:148331889-148331911 AAGTTGTGTGAGAGGGCAGGAGG + Intronic
1034715293 7:153236067-153236089 CACTTATGTGACTTGGCAGGAGG + Intergenic
1034723558 7:153315434-153315456 CACTTATCAGACGGGGCAGCCGG + Intergenic
1034894725 7:154869115-154869137 CACTGAGCTGAAAGGGCAGGGGG + Intronic
1035738516 8:1907399-1907421 ATCTTGTCTCCCAGGGCAGGTGG - Intronic
1036169416 8:6468330-6468352 TGCTTGTAGGACAGGGCAGGTGG - Intronic
1036482988 8:9154159-9154181 CACTTCTCAGACGGGGCAGCCGG + Intronic
1036737173 8:11329960-11329982 CACTTCTCAGACAGGGCGGCCGG - Intergenic
1037910595 8:22741588-22741610 CACTTGCCTGAGAGAGCAGTGGG - Intronic
1039892952 8:41696907-41696929 GCCTTGTCTGACAGGGCGGTGGG - Intronic
1040093396 8:43419804-43419826 CACTTCTCAGACGGGGCAGCTGG + Intergenic
1040121356 8:43687952-43687974 CACTTCTCAGACAGGGCGGCCGG + Intergenic
1041066253 8:54085701-54085723 CACTTGTCAGACAGGGCGGCTGG - Intronic
1042133993 8:65616816-65616838 CACTTCTCAGACAGGGCGGCCGG - Intronic
1042290760 8:67167609-67167631 CACTTCTCAGACAGGGCGGCCGG + Intronic
1042535612 8:69855674-69855696 CACTTCCCAGACAGGGCAGCCGG - Intergenic
1044581854 8:93833268-93833290 CACTTCCCAGACAGGGCAGCCGG + Intergenic
1051193965 9:14543047-14543069 CATTTGTCTGGTAGGGCAAGGGG - Intergenic
1051615355 9:19000486-19000508 CACTTCCCAGACAGGGCAGTGGG - Intronic
1053467997 9:38324748-38324770 CACTTCTCAGACGGGGCAGCCGG - Intergenic
1053498586 9:38566765-38566787 CAGTTGTCTCACACGGCAAGAGG + Intronic
1054708360 9:68485515-68485537 CACATGTCTTACATGGCAGCAGG - Intronic
1056404074 9:86257608-86257630 CGCTTGTCTGACATGGCAGCTGG + Intronic
1056885813 9:90442687-90442709 CTATTTTCTAACAGGGCAGGAGG - Intergenic
1059898087 9:118891051-118891073 CACTTGTCTTACAGTTCTGGGGG - Intergenic
1060041508 9:120305022-120305044 CACTTCTCAGACAGGGCGGCCGG - Intergenic
1060053560 9:120393851-120393873 CACTAGTCAGACAGGAAAGGTGG - Intronic
1061143061 9:128780200-128780222 CACTTCTCAGACGGGGCAGCCGG - Intergenic
1061545177 9:131300188-131300210 CACATGCCTGGGAGGGCAGGAGG + Intronic
1062193026 9:135257337-135257359 CACTTGACTGTCAGGGCCGCTGG - Intergenic
1062310091 9:135930756-135930778 CACCTGTGTGCCAGGGAAGGTGG - Intergenic
1062732153 9:138116086-138116108 CTCTTGTCTGAAAGGGAAGCAGG - Intronic
1203547152 Un_KI270743v1:136986-137008 CAATTGTCTCACATGGCAAGGGG + Intergenic
1185738607 X:2512441-2512463 CACCTGCCAGACTGGGCAGGGGG - Intergenic
1189478900 X:41377882-41377904 GACCTGTCCCACAGGGCAGGAGG - Intergenic
1190384124 X:49868143-49868165 CACTGGTCTGACAGGAAAAGGGG + Intergenic
1190793590 X:53721742-53721764 CACTTCTCAGACGGGGCAGCCGG - Intergenic
1190980852 X:55455691-55455713 CATCTCTCTGACAGGGCAGCTGG - Intergenic
1190987845 X:55517489-55517511 CATCTCTCTGACAGGGCAGCTGG + Intergenic
1191828666 X:65392411-65392433 CACTTCTCAGACTGGGCAGCTGG - Intronic
1191835343 X:65457165-65457187 CACTTCTCAGACGGGGCAGCCGG - Intronic
1192252130 X:69422119-69422141 CACTTCTCAGACAGGGCGGCCGG - Intergenic
1192324819 X:70123164-70123186 CACTTCTCAGACTGGGCAGCCGG - Intergenic
1192477025 X:71452333-71452355 CACTTCTCAGACGGGGCAGCCGG + Intronic
1192813482 X:74568894-74568916 CACTTCTCAGATAGGGCAGCCGG + Intergenic
1192813509 X:74569011-74569033 CACTTCTCAGATAGGGCAGCCGG + Intergenic
1194181187 X:90713792-90713814 CACTTCTCAGACTGGGCAGCCGG - Intergenic
1196178904 X:112669216-112669238 CACTTGGCTGATAGGGCAGAGGG - Intronic
1196734349 X:118971783-118971805 CTCTTGGCTGCCAGTGCAGGAGG - Intergenic
1197341639 X:125282912-125282934 CACCTTTCTCATAGGGCAGGAGG + Intergenic
1199285449 X:146049767-146049789 CACTTCCCAGACAGGGCAGCCGG - Intergenic
1199707576 X:150444037-150444059 CACTGCTCTGGCAGGGAAGGCGG + Intronic
1200387440 X:155907871-155907893 CACTTCTCAGACAGGGCGGCCGG + Intronic
1201294748 Y:12453622-12453644 CACTTCCCAGACAGGGCAGCCGG + Intergenic
1201965308 Y:19726524-19726546 CATCTGTCTGTCAGGGCTGGGGG + Intronic