ID: 1180032836

View in Genome Browser
Species Human (GRCh38)
Location 21:45224030-45224052
Sequence CTGCACCTGCAGAAGGAGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 1, 2: 3, 3: 39, 4: 423}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180032827_1180032836 22 Left 1180032827 21:45223985-45224007 CCGTCACCACAGTGGGGTTTTGT 0: 1
1: 0
2: 1
3: 16
4: 156
Right 1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG 0: 1
1: 1
2: 3
3: 39
4: 423
1180032829_1180032836 16 Left 1180032829 21:45223991-45224013 CCACAGTGGGGTTTTGTTCAGGC 0: 1
1: 0
2: 0
3: 11
4: 109
Right 1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG 0: 1
1: 1
2: 3
3: 39
4: 423
1180032826_1180032836 27 Left 1180032826 21:45223980-45224002 CCGCTCCGTCACCACAGTGGGGT 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG 0: 1
1: 1
2: 3
3: 39
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180032836 Original CRISPR CTGCACCTGCAGAAGGAGAG GGG Exonic
901041775 1:6368450-6368472 CTGCACCTGCATATGGAGTGTGG - Intronic
901212214 1:7533178-7533200 CGGCACGTGCAGCAGGGGAGGGG - Intronic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
901377440 1:8849334-8849356 CTGCACCTGCAGAAGGTTGGGGG + Intergenic
901416577 1:9120648-9120670 CTTTAACTGCAGAAGGGGAGAGG + Intronic
901428610 1:9198987-9199009 CTGCCCCTGCGCAAGGAGACCGG + Intergenic
902707718 1:18217214-18217236 CTGCACTTCCAGATGCAGAGTGG + Intronic
904004592 1:27357109-27357131 CTTCACCTGCAGGGGGAGGGAGG + Exonic
904294203 1:29507209-29507231 CACCACCTGCAGAGGGTGAGGGG - Intergenic
905929378 1:41776529-41776551 CTTCACCTGCATAAGGACAAAGG - Intronic
906638686 1:47427760-47427782 CTGCAACTGCAGAGGAACAGTGG - Intergenic
907012854 1:50978911-50978933 CAGCACCTGCAGAAGCACAGTGG + Intergenic
907318908 1:53590482-53590504 CTCCACATCAAGAAGGAGAGAGG - Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907659218 1:56376686-56376708 CTGTTCCTGCAGATGCAGAGAGG + Intergenic
908081795 1:60588732-60588754 TTGCAACTTCAGAAGCAGAGAGG + Intergenic
908171908 1:61513213-61513235 AGGCAGGTGCAGAAGGAGAGAGG + Intergenic
909806150 1:79875925-79875947 CTGCAGCTGCAGTAGTGGAGAGG - Intergenic
910629885 1:89343637-89343659 CTGGACCTATAGAGGGAGAGAGG - Intergenic
910666784 1:89734134-89734156 CAGTACCTGGAAAAGGAGAGAGG + Intronic
910812731 1:91254273-91254295 CTGCAACTGCAGAAATATAGGGG + Intergenic
911474147 1:98355750-98355772 CTGCCCCTGCAGACGCAGGGAGG - Intergenic
912062065 1:105686323-105686345 CTGCACCTGGACAAGGGGAAGGG + Intergenic
912352067 1:109023397-109023419 CTGGCCCTGGAGAAGGAAAGTGG - Exonic
912595931 1:110875669-110875691 CTGCACCTGCAGTGGCAGATGGG - Intronic
913251923 1:116918937-116918959 ATGCACCTGCAGAAGGTTTGAGG + Intronic
913609614 1:120497271-120497293 CTGCAACAGCAGCTGGAGAGCGG - Intergenic
914581576 1:149024573-149024595 CTGCAACAGCAGCTGGAGAGCGG + Exonic
914802584 1:150972274-150972296 CTGCACCTCCATTAGCAGAGAGG + Intronic
914825729 1:151137069-151137091 CTGCACCTAGGGGAGGAGAGTGG + Exonic
916493487 1:165324186-165324208 GACCACCTGCAGAAGGTGAGGGG + Intronic
920845240 1:209588139-209588161 CAGCACCAGCAAAAGGAGGGTGG + Intronic
921407755 1:214799597-214799619 CTGCATCTGCAGCAGTAGAAGGG + Intergenic
922342415 1:224668658-224668680 CTGGACCAGAAGAAGGAGGGAGG + Intronic
922773517 1:228203589-228203611 TTGCACTTGCACAAGTAGAGAGG - Exonic
923688244 1:236169161-236169183 CTGCACCTGCAGTGGGAGCATGG - Intronic
924083351 1:240422007-240422029 CTGGACCTGCATGGGGAGAGAGG + Intronic
924623870 1:245684813-245684835 CTGGACATGCAGCAGGGGAGGGG - Intronic
924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG + Exonic
1062909168 10:1201251-1201273 CTGCATTTGCAGAGGGAGAGAGG - Intronic
1064020128 10:11802382-11802404 AGCCAACTGCAGAAGGAGAGAGG + Intergenic
1064200848 10:13283651-13283673 CTGCACCTGCTGCAGAAGTGTGG - Intronic
1064329372 10:14379361-14379383 CTTTACCCGCAGAAGGTGAGAGG + Intronic
1065181237 10:23128507-23128529 GTGCACCTGCACTAGGAAAGAGG - Intergenic
1065300426 10:24316139-24316161 CAGCACCTGAAGCAGGTGAGCGG - Intronic
1067708972 10:48633767-48633789 ATCCATCTGCAGAAGGAGATGGG + Intronic
1067709548 10:48637178-48637200 CTGAAGCTGCAGATGGAGACAGG + Intronic
1070422416 10:76250174-76250196 CTTCAGCTGGAGAAGGGGAGAGG + Intronic
1071354917 10:84784471-84784493 CTACATCTGCAGGAGGAAAGTGG - Intergenic
1071947790 10:90667186-90667208 CTCCAGCTCCAGATGGAGAGAGG + Intergenic
1073125118 10:101144594-101144616 GGGCAGGTGCAGAAGGAGAGGGG - Intergenic
1073289227 10:102405175-102405197 CTCTACCTGCAGAAGGTGCGGGG - Exonic
1074183956 10:111085498-111085520 CAGCACCTTCAGAAGGGGCGAGG + Intergenic
1074184444 10:111088466-111088488 CAGCACCTTCAGAAGGGGCGAGG - Intergenic
1074297023 10:112199383-112199405 CAGCAGCTGCAGGAGGAGATGGG + Intronic
1074507581 10:114085176-114085198 TGGCACCTGCAGAACGGGAGTGG + Intergenic
1075426458 10:122345497-122345519 GTGCACCTGCAAAAGGGGTGAGG + Intergenic
1075462922 10:122630739-122630761 CCTCACCTCCAGACGGAGAGGGG - Intronic
1076146741 10:128127777-128127799 CTGCAAATGCAGAAGCAGTGAGG + Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1078050361 11:7960500-7960522 CTGCAGGGGCAGATGGAGAGAGG - Exonic
1078621549 11:12913207-12913229 CTTTACCTGCACATGGAGAGGGG - Intronic
1078857916 11:15221460-15221482 ATCCACCTGCAGATGGAGAGAGG - Exonic
1079077553 11:17393456-17393478 TGGAACCTGGAGAAGGAGAGGGG + Intronic
1081620290 11:44615266-44615288 CTGCAGCTGAAGCAGGAGATGGG + Exonic
1082883253 11:58058754-58058776 CAGCAGCTGCAGAAGCAGATCGG - Intronic
1082936118 11:58658628-58658650 CTGCAGGTGCAGGAGGAGAGAGG + Intronic
1083478782 11:62930316-62930338 TTGCAGCTGCAGCTGGAGAGAGG - Intergenic
1083708643 11:64533986-64534008 AGGCAGGTGCAGAAGGAGAGCGG + Intergenic
1083902505 11:65650465-65650487 GAGGACCTGCAGAAGGTGAGGGG + Exonic
1084735287 11:71101539-71101561 CTCCATCTGCAGAGGGTGAGAGG - Intronic
1085517609 11:77120696-77120718 CTCCACCTGCAGGAGGCGGGAGG - Exonic
1085735045 11:79031656-79031678 CTGTACCTGTGGAAGGACAGTGG + Intronic
1086926206 11:92643255-92643277 CTGCACCGTCAGAAGCAAAGGGG + Intronic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087206763 11:95404545-95404567 CTGCAGCTGCTGTAGGAGATGGG + Intergenic
1088987441 11:114922101-114922123 CTGCATATGCTGAGGGAGAGAGG - Intergenic
1089796154 11:120982987-120983009 CTACGCATGCAGAAGCAGAGGGG - Intronic
1090075360 11:123577344-123577366 CTGCAGCGGCAGATGGAGAGAGG - Intronic
1090463979 11:126916809-126916831 ATGCACCTGCAGAAAGAAAGGGG + Intronic
1090639377 11:128717274-128717296 CTGGACCTGTGTAAGGAGAGAGG + Intronic
1091320645 11:134646900-134646922 CTCCAGGTGCAGAAGGGGAGGGG + Intergenic
1091668441 12:2435812-2435834 CTGCTCCTGAAGCAGGAGCGAGG + Intronic
1091697932 12:2640579-2640601 CTGCAGCTGAAGAAAGAGACTGG + Intronic
1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG + Intergenic
1094041066 12:26122434-26122456 CGGCAGCTGCAGAAGGCGAGAGG + Exonic
1094443871 12:30508639-30508661 CAGCACCTGCAGAAGGCCACAGG + Intergenic
1096494818 12:52033848-52033870 CTGGCCCTGAATAAGGAGAGGGG - Intronic
1096617293 12:52840822-52840844 CTGCACCTTCAGAGGGAGCACGG + Intronic
1098245830 12:68516833-68516855 CTAAACCTGCAGAGGTAGAGTGG - Intergenic
1098973846 12:76881551-76881573 GCGCGCCTGCAGAAGGATAGTGG + Intergenic
1101041878 12:100763623-100763645 CTGCTCCTGCAGCAGGACTGGGG - Intronic
1101739085 12:107486162-107486184 CTGCCCCTGCAGAAGGGCATTGG - Intronic
1102189670 12:110977652-110977674 CTGCAACGGCAGAAGGAAATGGG + Intergenic
1102347867 12:112171075-112171097 CTGGCCCTGCAGGAAGAGAGAGG - Intronic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103437237 12:120936440-120936462 CGGCACTTGCAGAGGGAGGGAGG - Intergenic
1103455294 12:121060480-121060502 CTGCTCCTGCAGCAGGAAATAGG - Intergenic
1103494624 12:121352126-121352148 CTGCCCCTGCTGCAGGTGAGAGG - Exonic
1104121682 12:125805937-125805959 CTGCATTGGCAGAAGGTGAGGGG + Intergenic
1104943173 12:132404296-132404318 TGGCACCTGCAGAAGGTCAGAGG - Intergenic
1105578146 13:21671807-21671829 CTGCAACTGCAGTAAGGGAGGGG + Exonic
1106641394 13:31587858-31587880 CTGCATCCTCAGAAGGGGAGGGG - Intergenic
1107175578 13:37394862-37394884 CTGCAGCTGCAGTGGGAGAGAGG - Intergenic
1107260119 13:38480713-38480735 CTACCCATGCTGAAGGAGAGGGG - Intergenic
1107868975 13:44729725-44729747 CTGCAGTTGCAGAGGCAGAGTGG + Intergenic
1107961544 13:45563646-45563668 CAGTACATGCAGAAGGGGAGAGG + Intronic
1108767017 13:53643774-53643796 GTTCACCTGAGGAAGGAGAGAGG + Intergenic
1112331591 13:98481092-98481114 CTGCACTTACAGAAGGGGTGGGG + Intronic
1113741726 13:112716129-112716151 CAGCATCTGCAGAAGGCCAGAGG - Intronic
1113788279 13:113014343-113014365 CTGCACCTGCAACAGGTGCGGGG + Intronic
1113901563 13:113800939-113800961 CTACACCTGCGGGAGGTGAGGGG + Intronic
1113901577 13:113800980-113801002 CTACACCTGCGGGAGGTGAGGGG + Intronic
1113913622 13:113856829-113856851 CCGTCCCTGCAGAAGCAGAGAGG - Intronic
1114084490 14:19229497-19229519 CAGCAGCTGAAAAAGGAGAGAGG + Intergenic
1114564723 14:23622131-23622153 CTCCAGCTGAAGAAGGTGAGAGG - Intergenic
1114629748 14:24151468-24151490 CTGCACCTGCAAGATGGGAGTGG - Exonic
1115754285 14:36517693-36517715 CAGCAACTGCAGCAGGACAGCGG - Exonic
1115984035 14:39085077-39085099 CCCAACCTCCAGAAGGAGAGAGG + Intronic
1117656357 14:57960487-57960509 CTCTACCTGGACAAGGAGAGAGG + Intronic
1118290028 14:64511320-64511342 CTGCTTCTGGAGAGGGAGAGAGG + Exonic
1118374716 14:65166855-65166877 TGGCACTTGCTGAAGGAGAGTGG + Intergenic
1119132760 14:72190088-72190110 GTGCACCTCCAGAAGAAAAGGGG - Intronic
1119524828 14:75314513-75314535 CAACACCTGTAGAAAGAGAGGGG - Intergenic
1120139144 14:80908286-80908308 TTGCATTTCCAGAAGGAGAGGGG - Intronic
1120715880 14:87840293-87840315 CTGTAACTGCAGAGGGAGACTGG - Intronic
1121308410 14:92922005-92922027 CAGCAGCCGCAGATGGAGAGGGG + Intergenic
1121693543 14:95894621-95894643 CAGCACCTGCAGAAGGTCATGGG - Intergenic
1122229549 14:100298880-100298902 CCACACCTGGAGGAGGAGAGGGG + Exonic
1122905053 14:104797775-104797797 CAGCAGCTGCAGAAGGTGACAGG - Intergenic
1123187261 14:106531613-106531635 CAGGACCTGCAGGAGAAGAGGGG + Intergenic
1123413979 15:20081813-20081835 CTGGCCCTGCAGGAGGAGAAAGG + Intergenic
1123523321 15:21088924-21088946 CTGGCCCTGCAGGAGGAGAAAGG + Intergenic
1123861973 15:24477454-24477476 CTACACCTGCAAAAGGACTGAGG - Intergenic
1124521295 15:30408227-30408249 CTGAACATATAGAAGGAGAGAGG - Exonic
1124529192 15:30488617-30488639 CTGCAACAGGAGAACGAGAGAGG - Intergenic
1124537367 15:30557990-30558012 CTGAACATATAGAAGGAGAGAGG + Exonic
1124761288 15:32449597-32449619 CTGAACATATAGAAGGAGAGAGG - Exonic
1124769470 15:32519076-32519098 CTGCAGCAGGAGAACGAGAGAGG + Intergenic
1124777346 15:32599466-32599488 CTGAACATATAGAAGGAGAGAGG + Exonic
1126104233 15:45136814-45136836 CTACACCAGCAGCAGGAGAATGG - Intronic
1127331466 15:57943963-57943985 TTCCCCCTGCAGGAGGAGAGAGG + Intergenic
1128114380 15:65096133-65096155 CTTCACCTTCAGAAGGAGGGCGG + Intronic
1128292505 15:66488723-66488745 CAGCACCTGCAGAAGCAAACCGG - Intronic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1129059941 15:72852850-72852872 CTGCACCTGCCACAGGAGAAAGG + Intergenic
1129725415 15:77899163-77899185 CTGCACCTCCAGCAGCACAGTGG - Intergenic
1129785425 15:78306898-78306920 TGGCATCTGTAGAAGGAGAGGGG - Intergenic
1130537867 15:84799825-84799847 CAGTACCTGCAGAAGCACAGCGG - Exonic
1130965465 15:88694475-88694497 CGGCATGTGAAGAAGGAGAGGGG + Intergenic
1131503575 15:92995588-92995610 CTGCAACTGTAAAAGGAAAGAGG - Intronic
1132298355 15:100761219-100761241 CTGCACCCTCAGCTGGAGAGAGG - Intergenic
1132556887 16:576458-576480 CAGCCCCTTCAGAAGGAAAGGGG - Intronic
1132740000 16:1407323-1407345 CTGCACCTGCCGGACGACAGAGG + Intronic
1132931384 16:2460705-2460727 CAGCACCTGGAGAAGGCGGGTGG - Intronic
1132995071 16:2818482-2818504 CTGCTCCTGCAGCAGAAGGGTGG - Intronic
1133173607 16:3997556-3997578 CTGCGCTTGCAGAAGGAAGGGGG + Intronic
1133303930 16:4798532-4798554 CAGCCCCTGCTGCAGGAGAGGGG - Intronic
1134053014 16:11150513-11150535 CTGCACGTGCACACAGAGAGAGG - Intronic
1134187386 16:12095390-12095412 CCGCAGCTGCGGAAGGAAAGCGG - Intronic
1134209924 16:12267591-12267613 CTGCTCCTGCAGGATGAGGGAGG - Intronic
1134859247 16:17546342-17546364 CTTCATCTGCAGAAGTAGACGGG - Intergenic
1135397166 16:22139993-22140015 CTGAATCTGCTGCAGGAGAGGGG + Intronic
1135482232 16:22830466-22830488 TTGCACCTGTAGAATGACAGAGG + Intronic
1135960610 16:26991699-26991721 CTGCAACTGCCGAGGGAGAAGGG + Intergenic
1135965804 16:27034064-27034086 ATGCACAGGCAGAAGGAGAAAGG + Intergenic
1136344714 16:29667195-29667217 CTGCAGCTGCAGAATGACAGAGG + Exonic
1136487263 16:30581651-30581673 GTGCACTTGCAGAATGAGAGTGG + Exonic
1138122703 16:54413267-54413289 GTGCAAGTCCAGAAGGAGAGGGG + Intergenic
1139239419 16:65375600-65375622 CTCCACCTGCCCAAGCAGAGTGG + Intergenic
1139601484 16:67990121-67990143 CCGCCCCTGCAGAAGAAGAACGG - Exonic
1140040159 16:71402209-71402231 CTGCAGCTGCAGCAGGGCAGGGG - Intergenic
1140476877 16:75243408-75243430 CTGGACCAACACAAGGAGAGCGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141951027 16:87339495-87339517 CAGCCCCTGCAGAAGAGGAGAGG + Intronic
1142669378 17:1480698-1480720 CTGTACCTGGTGAAGGTGAGTGG - Exonic
1142737382 17:1909828-1909850 CTGCTCCTGCACACGGAGAAAGG - Intergenic
1143030257 17:3963809-3963831 CTGCACCTGCAGGATGCCAGCGG + Intronic
1143665857 17:8359673-8359695 CTGCACCTACAGATGAAGAAGGG + Intergenic
1144338659 17:14295684-14295706 CTGCACCTGTAGAAGGAAGGAGG + Intergenic
1144852696 17:18251991-18252013 CTGCAGCTGCAGCTGGTGAGTGG - Exonic
1145993095 17:29090915-29090937 CTGCTCCTCCAGCTGGAGAGAGG + Exonic
1146468316 17:33104624-33104646 CTGCTCCTGAAGAAGAAAAGAGG + Intronic
1146547132 17:33749268-33749290 GAGCAGCTGGAGAAGGAGAGGGG - Intronic
1147258388 17:39195388-39195410 CTGCTCCTGCGGAGGGGGAGTGG - Intronic
1149208709 17:54278921-54278943 CTGCACCTGCTGACAGAGTGAGG - Intergenic
1150470915 17:65436920-65436942 CTGCAGCTGTAGTTGGAGAGAGG - Intergenic
1151063697 17:71126321-71126343 CTGCTCCTACAGAAAGAGAATGG - Intergenic
1151195379 17:72427528-72427550 CAGCCCTTGCAGTAGGAGAGCGG + Intergenic
1151293142 17:73164894-73164916 CGGGTCCTGCAGAAGGACAGGGG - Intergenic
1151784983 17:76271067-76271089 CTGCACATTCAGCAGGAGACAGG - Exonic
1151944701 17:77313189-77313211 CTGCCCCTGCAGAGCGAGGGAGG - Intronic
1152558582 17:81066832-81066854 CTCCACCTGCAGGAGGAGGCTGG - Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152717095 17:81905442-81905464 GTCCACCTGGAGAAGGAGTGGGG + Exonic
1152737471 17:82004486-82004508 CTTCACCTGCAGGAGGAGTCGGG + Intronic
1152784846 17:82242234-82242256 CTGCACAGGCACAAGGAGATAGG - Intronic
1152797556 17:82315620-82315642 GTGCCTCTGAAGAAGGAGAGTGG + Intronic
1153893136 18:9536494-9536516 TTAGAACTGCAGAAGGAGAGAGG - Exonic
1154083585 18:11280853-11280875 CTGCATCTGCAGAGGAAGTGCGG + Intergenic
1155071403 18:22320135-22320157 CTGCACCTGCAGAGTGAGGCAGG + Intergenic
1156627875 18:38931575-38931597 CTGCACCTCCAGAAAGAGGAGGG + Intergenic
1158025992 18:52898120-52898142 CTGCAACTGCCAGAGGAGAGCGG - Intronic
1158396348 18:57081121-57081143 CTGCACCTGCAGAGGAAAGGGGG + Intergenic
1158452590 18:57580530-57580552 CTGCTCCTGTGGAAGGAGAAGGG + Intronic
1158762980 18:60412273-60412295 GTGCACATGCAGAATGAAAGAGG - Intergenic
1158941789 18:62411565-62411587 CTGAGCCTCCAGAAGGAGTGTGG - Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160185469 18:76673407-76673429 CGGAACCTTCAGAAGGAGATGGG - Intergenic
1160510027 18:79448247-79448269 CTGCCTCTGCAGGAGGAGAGGGG + Intronic
1160895315 19:1399642-1399664 CCCCACCTGCAGAAAGGGAGCGG + Intronic
1161025253 19:2033831-2033853 CTGCAGCTGCAGTGGGAGGGAGG - Intronic
1161114291 19:2488257-2488279 CTGCATCTGGAGAAGGGGTGGGG + Intergenic
1161408218 19:4102248-4102270 TGGCCCCTGCAGAAAGAGAGTGG - Intronic
1161921301 19:7268201-7268223 CGGCAGGTGCAGAAGGAGAAAGG + Intronic
1162241986 19:9362705-9362727 CTGCAGCCGCAGAGGGAAAGGGG - Intronic
1162646850 19:12056360-12056382 CTCCAGCTCCAGAAGGAGTGTGG - Intergenic
1162739950 19:12768118-12768140 CTGCACCTGAACACAGAGAGGGG + Exonic
1163133091 19:15288747-15288769 CTGCCCCTGCAGATGGAGGAGGG + Intronic
1164031806 19:21413918-21413940 CAGCAGTTGCAGAAGGAGACGGG - Intronic
1164541165 19:29122501-29122523 CTTCTTCTCCAGAAGGAGAGGGG - Intergenic
1165740626 19:38203294-38203316 CTGCAGCTGCAGAGGGAGATGGG - Intronic
1166831826 19:45643823-45643845 CTGGACCTGCAGAGGGAGGTGGG + Intronic
1166885965 19:45961051-45961073 GTGCAGCTGCAGAAGGAGACCGG - Exonic
1167733377 19:51275735-51275757 CTGCAGCTGAGGAAGGACAGTGG - Intergenic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
925912942 2:8584863-8584885 CTTCACCTGCAGGAGGAGCTGGG - Intergenic
926646044 2:15290754-15290776 ATGAACCTCCAGAAGGACAGAGG + Intronic
927151730 2:20200142-20200164 CTGCACCTGCTGATGGAGCAGGG - Intergenic
927638457 2:24832233-24832255 CAGCAGCTGCAGCTGGAGAGTGG - Intronic
927939475 2:27094715-27094737 CTGGACCTCCAAAAGGAGTGGGG - Intronic
928027615 2:27752877-27752899 CCACACCCACAGAAGGAGAGGGG + Intergenic
929611949 2:43277221-43277243 CATTACCTGCAGAAGGAGATCGG + Intronic
929764550 2:44833242-44833264 CTGCCCCTGCAGAGGGACTGTGG - Intergenic
931228807 2:60356681-60356703 CTGCATCCCCAGAAAGAGAGAGG - Intergenic
931322566 2:61185485-61185507 CTGAACCTGGAGAAGGGAAGAGG - Exonic
931695657 2:64868760-64868782 CTGCACCTGAGGACTGAGAGTGG + Intergenic
932511443 2:72296893-72296915 CTAAACCTGCAGAAGGAAGGAGG + Intronic
933093059 2:78145783-78145805 CTGCACTTGCACATGGAGTGTGG + Intergenic
935106607 2:100050784-100050806 CTGCCCCTGCAGATGCAGATGGG + Intronic
936618725 2:114073594-114073616 GTCCACCTGTGGAAGGAGAGAGG + Intergenic
938014120 2:127853191-127853213 CTGCCCCTGCAGAAATCGAGGGG + Intronic
938159345 2:128971791-128971813 CGGCACCTCCAGAAGAAAAGGGG - Intergenic
938228986 2:129641562-129641584 GTCCACCTGCAGAGGGAGAGGGG - Intergenic
938775024 2:134534059-134534081 CTGGACCTAAAGAAGGAGATGGG - Intronic
939677292 2:145088302-145088324 CTGCACGTGCAGAAGCCCAGGGG + Intergenic
940241356 2:151566561-151566583 CTGCACATGCAGAAGGCTGGTGG + Intronic
940332078 2:152485811-152485833 CTTTACCTGTAGAATGAGAGGGG - Intronic
940612457 2:156007406-156007428 CTGCACTTGCACATGGAGGGTGG - Intergenic
942178100 2:173354619-173354641 GCGCAGCTGCACAAGGAGAGTGG + Intergenic
942319796 2:174726275-174726297 CTGCCCCAGCAGCAGGAGTGAGG - Intergenic
944796892 2:203196216-203196238 CTGCACCTGCAGATGGAACTTGG - Intronic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
945911563 2:215655861-215655883 TTACACCTGGTGAAGGAGAGAGG - Intergenic
946028291 2:216685721-216685743 GTGCATTTGCAGAAGGAGAAAGG + Intronic
946051992 2:216870778-216870800 ATGGACCTGCGGTAGGAGAGAGG + Exonic
947005665 2:225508600-225508622 TAGCACCTGTAGAAGGAGAGGGG + Intronic
947453978 2:230236242-230236264 CTGTAACTGCAAAAGGAGGGTGG - Intronic
947633095 2:231666276-231666298 CTGCATGTGCAGCAGGAGGGAGG - Intergenic
947845100 2:233237432-233237454 CTGACCCTGGTGAAGGAGAGAGG + Intronic
947959606 2:234224699-234224721 CAGAATCTGCAGAAAGAGAGGGG - Intergenic
948538809 2:238670174-238670196 CTGCACCTGCAGAATCAGCCAGG - Intergenic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
948657252 2:239484268-239484290 CAGCTCCTGCAGAAGAAGCGAGG + Intergenic
948995441 2:241576024-241576046 CTGCAGTGGGAGAAGGAGAGTGG - Intergenic
949070318 2:242020560-242020582 CTGCAGCTGCAGACCCAGAGAGG + Intergenic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1170534297 20:17324808-17324830 CAGCATCTGCAGAAGGAAATGGG + Intronic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1171162949 20:22945009-22945031 CTGCACCTGCACAAGGACTCTGG + Intergenic
1171179154 20:23079197-23079219 CTGCACCTGCTGGAGGCGACAGG - Intergenic
1174127398 20:48317122-48317144 CTTCACTTCCAGAAAGAGAGTGG + Intergenic
1174726886 20:52871747-52871769 CTGCACCCCCAAAAGAAGAGAGG - Intergenic
1176057291 20:63155468-63155490 CTGCACCTGCTAAAGGGCAGAGG + Intergenic
1176070560 20:63224137-63224159 CTCCACATGCAGAGTGAGAGGGG - Intergenic
1176244710 20:64091922-64091944 CTGCAGCTCCAGAAGGGGAGGGG - Intronic
1176365699 21:6031587-6031609 CTCAGCCTGCAGAAGGAGTGGGG + Intergenic
1176709384 21:10136409-10136431 CAGGAGCTGCAAAAGGAGAGAGG - Intergenic
1178787169 21:35664374-35664396 CTCCACCCACAGAAGGAGAGGGG + Intronic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179757817 21:43506958-43506980 CTCAGCCTGCAGAAGGAGTGGGG - Intergenic
1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG + Exonic
1180219388 21:46348335-46348357 CTGCATCTGCACAAAGCGAGAGG - Intronic
1180703342 22:17793740-17793762 CAGCAAGGGCAGAAGGAGAGAGG + Intronic
1180735396 22:18012609-18012631 GTGCTCCTGCAGGAGGAGACTGG - Intronic
1180858729 22:19064568-19064590 CTGCACTTGTACAAGGAGAGGGG + Intronic
1181437933 22:22921198-22921220 CTTCACCCCCAGAGGGAGAGGGG - Intergenic
1181932879 22:26417032-26417054 TTGCAGCTGCAGAAAGAGAGAGG + Intergenic
1182546140 22:31077754-31077776 CTGGCCCTGCAGGAGGAGAAGGG - Intronic
1183442657 22:37831961-37831983 CTGCATCTGCAGACTGAGGGAGG + Exonic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183725994 22:39590018-39590040 CTGGGCCTGCAGAAGGAGGGTGG + Intronic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1185168344 22:49276169-49276191 CTGCACTGGCAGATTGAGAGTGG + Intergenic
1185313974 22:50170843-50170865 CTTCAGCTGCAGAAGCAGCGCGG - Exonic
951260008 3:20496135-20496157 CAGCACCTGCATGTGGAGAGAGG - Intergenic
951645996 3:24891919-24891941 CTGCACCCACAGAAGTAGATGGG + Intergenic
952029399 3:29123183-29123205 GTGCACCTGGAGAAGTAGACAGG + Intergenic
952778798 3:37072877-37072899 CTTCTCCTGCAGAGGAAGAGGGG + Exonic
953319825 3:41961881-41961903 GTCCACTGGCAGAAGGAGAGAGG + Intronic
953441861 3:42925128-42925150 CTGGAGCTGCAGAAGTGGAGAGG + Intronic
953609227 3:44433653-44433675 CCGGACCTGCAGAGAGAGAGTGG + Intergenic
955060546 3:55488658-55488680 CGGCATCTGCTGAAAGAGAGAGG + Intronic
955435926 3:58899107-58899129 CTGCACCTGTAGGAGGAGGCTGG + Intronic
955766717 3:62351947-62351969 CATCAGTTGCAGAAGGAGAGTGG - Intergenic
956084915 3:65598214-65598236 CTGCACCTGCGGAGGGGGCGGGG + Intronic
956864439 3:73355565-73355587 CAGCACCTTCAGAGGGAGCGGGG + Intergenic
957828733 3:85487459-85487481 CTGCATCTGAAGAAGAAGAAAGG + Intronic
959259204 3:104053211-104053233 CTGAACCTGCAGGAGGATGGAGG - Intergenic
959950400 3:112174741-112174763 CTGCAACTGTAGTAGCAGAGGGG + Intronic
960285152 3:115819868-115819890 CTGCTCCTACAGAAGGTGATGGG - Intronic
960537535 3:118829875-118829897 CTGCACCTGCAAATGCAGATTGG - Intergenic
960813116 3:121644127-121644149 CTGCAGCTGCACACAGAGAGAGG - Intronic
961410776 3:126718799-126718821 CTGCACCAACAGAACCAGAGGGG - Intronic
961499075 3:127318193-127318215 CTTCACCTGCAGCCTGAGAGGGG + Intergenic
961569052 3:127785202-127785224 CTCCACCTGCAGCAGGTGTGTGG - Intronic
961915733 3:130372650-130372672 CAGCACCTATAGAAGGGGAGTGG + Intronic
962230575 3:133661994-133662016 CGGCAGCTGCAGCAGAAGAGCGG + Intergenic
962400098 3:135050997-135051019 CTTCTCCTGCAGAGAGAGAGGGG + Intronic
962731675 3:138289411-138289433 ATGCACTTGAAGAAGGTGAGAGG + Intronic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
963748454 3:149149513-149149535 AAGCACCAGCAGATGGAGAGAGG + Intronic
964601256 3:158503559-158503581 CTGCACCTGCTGTTGGAGATGGG + Intronic
966248319 3:177833599-177833621 ATGCACGTGCAGAAGAAGACAGG + Intergenic
966821073 3:183924994-183925016 CCGCACCTGCAAAGGAAGAGTGG + Intronic
970859393 4:20684257-20684279 CTGCTCCTGCAGAAGGTGAAGGG + Intergenic
971533858 4:27722991-27723013 GTGCACATGCAGAGGGAGAAAGG + Intergenic
972963903 4:44486487-44486509 CTACAACTGCTGAAGGAGGGAGG - Intergenic
975321064 4:73011124-73011146 CTGCACCTGCACAAGGAACATGG + Intergenic
976204956 4:82615998-82616020 CTACCTCTGCGGAAGGAGAGCGG - Intergenic
976480217 4:85534443-85534465 CTGCTCCAGCAGAAGGAATGTGG + Intronic
976512731 4:85930049-85930071 CTGCACCTGCTGAATGTGACCGG + Intronic
977971440 4:103218283-103218305 CTGCAACTGCAGTGGCAGAGGGG - Intergenic
980343617 4:131583810-131583832 CTGCAATTGCTGATGGAGAGAGG + Intergenic
984029123 4:174581523-174581545 CTGAAGCTTGAGAAGGAGAGAGG - Intergenic
984839306 4:184053184-184053206 CAGCACATTCAGAAGTAGAGAGG + Intergenic
985017410 4:185651014-185651036 TTGCAGCTGCTGAAGGGGAGGGG + Intronic
985174729 4:187188857-187188879 CTGAACCTAAAGAAAGAGAGTGG - Intergenic
985561905 5:592242-592264 CTGCAGCTGCTGTAGGAGATGGG + Intergenic
985938901 5:3118483-3118505 GGGCAACTGCAGAAGGAGGGTGG - Intergenic
986107678 5:4675656-4675678 CTCCTACTTCAGAAGGAGAGGGG - Intergenic
986147057 5:5088122-5088144 CTGCACCTGTAGAAAGGGAGTGG - Intergenic
986639750 5:9860646-9860668 CTGATACTGCGGAAGGAGAGAGG + Intergenic
986745003 5:10736160-10736182 CAGCGCCTGCAGAGGGAGTGTGG + Intronic
986865074 5:11976679-11976701 CCAGACCTGCAGAAGGTGAGGGG + Intergenic
987302107 5:16606296-16606318 GAGCACCTTGAGAAGGAGAGTGG - Intronic
987353372 5:17041222-17041244 CTGCACCTACTGCAGGAGGGAGG + Intergenic
987856092 5:23422731-23422753 TTGCAGCTGCTGATGGAGAGAGG - Intergenic
988968409 5:36442408-36442430 CTGCACGTGCACTAGGAGAGAGG - Intergenic
989003668 5:36786740-36786762 TTTCTCCTGCAGAAGAAGAGAGG + Intergenic
991917644 5:71620957-71620979 CTGCATCTGCATCAGGACAGAGG - Intronic
992383982 5:76266060-76266082 CTCTACCTGCAGAAGGTGAGAGG + Intronic
994948161 5:106423243-106423265 CAGCACCAGCAGAGGGTGAGAGG - Intergenic
995835360 5:116395164-116395186 CTGCTTCTTCAGAGGGAGAGGGG - Intronic
996998100 5:129724028-129724050 CTGCACTTGCATAAGAACAGTGG - Intronic
998373975 5:141679652-141679674 GTGCACTGGCAGGAGGAGAGGGG + Exonic
998747988 5:145283511-145283533 CAGCAAATGCAGAGGGAGAGGGG - Intergenic
999542070 5:152584788-152584810 CTGCAGCTGCAGTGGCAGAGGGG + Intergenic
1000411417 5:160937729-160937751 CTGCAACTGCTGATGGAGGGAGG + Intergenic
1001286995 5:170431044-170431066 CAGCATCTGCAGATGGAGTGAGG - Intronic
1001509443 5:172308894-172308916 CTGCAGCTGCACAAAGAAAGAGG + Intergenic
1001751241 5:174133240-174133262 CTGAACCAGGAGGAGGAGAGGGG - Intronic
1001997696 5:176175171-176175193 CGGCACCTGCAGAAAAAGTGGGG - Intergenic
1003058113 6:2841402-2841424 CTGCAGCTGCAGGGAGAGAGAGG - Intronic
1004456408 6:15795859-15795881 CTGCACATGTAGAGAGAGAGAGG - Intergenic
1006256326 6:32835471-32835493 CTTCACTTGCAGAGGGACAGTGG + Intronic
1006343384 6:33459927-33459949 CTGCATCTTCTGAAGGACAGAGG - Intergenic
1007131280 6:39476509-39476531 CTGCACCATCAGAAGGAGCTGGG + Intronic
1007272130 6:40645887-40645909 CAGCACATGTAGAAGGGGAGGGG + Intergenic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1008709907 6:54212284-54212306 CTTCACCCGCACAATGAGAGTGG + Intronic
1008714408 6:54271518-54271540 TAGCACGTGCAGAAGAAGAGAGG - Intergenic
1010251773 6:73714485-73714507 CAGCACCTGCAGAAGGGAAAGGG - Intronic
1011381219 6:86744119-86744141 CAGCACCTGGCAAAGGAGAGGGG + Intergenic
1012351821 6:98260822-98260844 GGGCATATGCAGAAGGAGAGAGG + Intergenic
1016429526 6:143968060-143968082 CTGCAGCTGCAAAAGAAGTGAGG + Intronic
1017041811 6:150314253-150314275 GAGCACCTGCAGAAGGGGAGAGG + Intergenic
1017561823 6:155636400-155636422 CTCAACCTGCAGAAGGATAAGGG + Intergenic
1017901359 6:158720971-158720993 GTGCACATGCAGCAGGGGAGGGG - Intronic
1018393778 6:163361349-163361371 TTGCAGATGCAGAAGGGGAGAGG - Intergenic
1018745285 6:166757197-166757219 CTGCAAGTGCAGAAGCAAAGGGG - Intronic
1019528149 7:1490169-1490191 CAGCACCTGCCGAAGGAGAGAGG + Intronic
1019570449 7:1709074-1709096 CTGCACCTGCACAGAGACAGAGG - Exonic
1019701364 7:2476337-2476359 CTGGACCTGGAGAAGGAGAACGG - Intronic
1020777305 7:12471085-12471107 CTGAACCTGAGGAAGGCGAGGGG - Intergenic
1021840157 7:24715887-24715909 CTTCATTTGCAGAATGAGAGAGG + Intronic
1021922970 7:25505653-25505675 CTGCTGCTGGAGAATGAGAGAGG - Intergenic
1022536216 7:31100274-31100296 CTGCCGCTGCTGGAGGAGAGTGG + Intronic
1022588837 7:31642159-31642181 TGGCACCTGCAGAATGAAAGAGG - Exonic
1023652688 7:42388277-42388299 CTGTACCTACAGAAGGGGATGGG - Intergenic
1023862601 7:44225265-44225287 CTGCCCTTGCAGAAGTGGAGGGG - Intronic
1026104966 7:67413616-67413638 CTGCTCCTGCAAAATGAGACAGG - Intergenic
1026442622 7:70457411-70457433 CTACCCCTCCAGAAGGAGAGAGG - Intronic
1028372098 7:90103957-90103979 CTGGACTTGAAGAAGGAGAAAGG - Intergenic
1028411652 7:90536829-90536851 CTGGCCCTGCTGATGGAGAGTGG - Intronic
1030375162 7:108745657-108745679 ATGCACCTGCAGAAGGTGGTTGG + Intergenic
1031207631 7:118781049-118781071 CTGCAACTGCAGGAGGATAATGG - Intergenic
1031979581 7:128116029-128116051 CTGCAAATGCAGGAGGAGATAGG + Intergenic
1032488453 7:132305975-132305997 CTGGAACTGTAGATGGAGAGGGG + Intronic
1032785482 7:135196559-135196581 CAGGCCCTGCTGAAGGAGAGGGG + Intronic
1033127285 7:138717225-138717247 CTGCATCTGCAGGAGGATGGAGG + Intronic
1034098930 7:148435502-148435524 CGGCTCCTGCAGAGGGAGGGAGG - Intergenic
1034179229 7:149125136-149125158 CTGTACCTGCCAAAGGAGGGTGG + Intronic
1034934027 7:155187068-155187090 TTGCACATGCATCAGGAGAGTGG - Intergenic
1035557603 8:578482-578504 CTTCACCTGCCGAGGGACAGGGG - Intergenic
1035923950 8:3707665-3707687 CTGCACCTGCAGAGAAAGAAGGG + Intronic
1037896269 8:22658542-22658564 CTGCCTCTGCAGAGGGAGTGAGG - Intronic
1038043071 8:23743033-23743055 CTCCACCTATGGAAGGAGAGAGG - Intergenic
1039039439 8:33393545-33393567 ATGCTCCTGCAGAAGGAGAGGGG - Intronic
1039433165 8:37541557-37541579 CTGCACCTGCGGTGAGAGAGGGG + Intergenic
1039571209 8:38587860-38587882 CTGCACCTGCAGAAGATGAAGGG - Intergenic
1040510272 8:48087217-48087239 CTGGAGCTGCTGCAGGAGAGGGG + Intergenic
1040530062 8:48259966-48259988 CAACACCTGAAGAAGGAGAGGGG + Intergenic
1040616568 8:49043505-49043527 CAGCACCTACAGAAGGAGAAGGG + Intergenic
1042651399 8:71045888-71045910 CAGTAGCTGCAGAAGGAAAGAGG + Intergenic
1042898278 8:73694883-73694905 CAGCACCTGCACAGGGAGGGAGG + Intronic
1045385460 8:101667586-101667608 ATGCCCATGGAGAAGGAGAGGGG - Exonic
1045508290 8:102794267-102794289 CTGCGCAGGCAGATGGAGAGAGG - Intergenic
1046480994 8:114818317-114818339 CTGCAGCTGAAGCAGGAGAATGG + Intergenic
1047391126 8:124452138-124452160 ATGCACCTGCTGAAGAAGAGTGG - Exonic
1048950120 8:139489757-139489779 CAGCCCCTGCAGAAGGAAACAGG + Intergenic
1049091733 8:140519868-140519890 CTGCTCCTGCAGCATGAGAAAGG - Intergenic
1049442906 8:142617311-142617333 CTAGACCTGCACAAGGAGATTGG + Intergenic
1049719351 8:144108457-144108479 CTGCACCTGCACAAGGAAGACGG + Exonic
1049788648 8:144463004-144463026 CCGCCCCTGCAGAAGGTGGGCGG + Intronic
1049945111 9:586861-586883 CTGCACCCCCAGCAGGAAAGTGG + Intronic
1051050879 9:12930212-12930234 CTGCACCTGCACAGGGACTGAGG + Intergenic
1051520379 9:17980880-17980902 CTGCCCATGCAGAAGGTGAAGGG + Intergenic
1051995101 9:23205770-23205792 GTGTACCTGTAGAAAGAGAGAGG + Intergenic
1053537283 9:38938186-38938208 CAGCACCAGTGGAAGGAGAGCGG - Intergenic
1053897461 9:42757193-42757215 CTGCAGCAACAGAAGGAAAGTGG - Intergenic
1054628852 9:67425744-67425766 CAGCACCAGTGGAAGGAGAGCGG + Intergenic
1055829391 9:80360475-80360497 CTGCTGCTGCAGAGGGTGAGTGG + Intergenic
1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG + Intronic
1057776843 9:98018294-98018316 CAGCACCTGAAGAATGATAGTGG + Intergenic
1058038425 9:100278345-100278367 CTGCATATGAAGAATGAGAGAGG - Intronic
1058242641 9:102585387-102585409 CTGCAACTGCCTAAGGATAGTGG - Intergenic
1058328960 9:103734912-103734934 CAGCAACTGCAGAGGGATAGTGG - Intergenic
1059646958 9:116277064-116277086 CAGCATCTGCTGGAGGAGAGGGG + Intronic
1059779134 9:117508110-117508132 CTGCAGCTGCAATGGGAGAGGGG + Intergenic
1060055310 9:120408175-120408197 CTGTTCCTTCAGAAGAAGAGTGG + Intronic
1061510281 9:131056912-131056934 CTGGACCTGCAGAGCGAGAAGGG - Exonic
1062309156 9:135926659-135926681 CAGCACCAGCTGAAGGAGAGAGG - Intergenic
1062353189 9:136149027-136149049 CTGCACCTCCAGGAGGGCAGCGG + Intergenic
1202794143 9_KI270719v1_random:105376-105398 CAGGAGCTGCAAAAGGAGAGAGG - Intergenic
1185553468 X:1002245-1002267 CAGACCCTGGAGAAGGAGAGGGG + Intergenic
1187077003 X:15945390-15945412 GGGTACCTGCAGAATGAGAGAGG - Intergenic
1187446931 X:19368671-19368693 CTGCCCCTGCAGAAGTAGCAGGG - Intronic
1189041091 X:37542828-37542850 CAGCACCTGTAGTAGGAGACTGG + Intronic
1189280729 X:39818752-39818774 TGACCCCTGCAGAAGGAGAGGGG + Intergenic
1192310879 X:70013196-70013218 CTGCAGCTGCAATGGGAGAGGGG - Intronic
1192434556 X:71135080-71135102 CTGTGCCTGCAGAAGGAGTTGGG + Exonic
1194281308 X:91957684-91957706 ATGCACCTGTAGGAGGAGACTGG + Intronic
1194588141 X:95763008-95763030 CTGCACATGCACAAAGAAAGGGG + Intergenic
1194763042 X:97816843-97816865 CTGCCCTTGCAGAAAGGGAGAGG - Intergenic
1195004859 X:100676002-100676024 CTGGACCTGCAGAAGAGGACAGG + Exonic
1195016363 X:100785588-100785610 CTGCATATGCAGAAGCAGACAGG - Intergenic
1196794419 X:119490768-119490790 CTGCACCTGCAGAGGGAGATTGG - Intergenic
1199320587 X:146433535-146433557 CTTCACCAGCAGAGGCAGAGTGG - Intergenic
1199448875 X:147957563-147957585 TTTCACCTGCTGAATGAGAGTGG - Intergenic
1199596033 X:149506491-149506513 CAACACCTGTAGAAGGGGAGGGG - Intronic
1199979352 X:152912371-152912393 TTGCACATGCAGAATGACAGAGG - Intergenic
1200247891 X:154535554-154535576 CTGCACATCCAGAGGGAGGGAGG + Intronic
1200598896 Y:5182340-5182362 ATGCACCTGTAGGAGGAGACGGG + Intronic