ID: 1180032915

View in Genome Browser
Species Human (GRCh38)
Location 21:45224490-45224512
Sequence TCCCCACAGCTGCCCCACCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 0, 2: 7, 3: 55, 4: 513}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180032915_1180032928 17 Left 1180032915 21:45224490-45224512 CCTGGGTGGGGCAGCTGTGGGGA 0: 1
1: 0
2: 7
3: 55
4: 513
Right 1180032928 21:45224530-45224552 GCCCTGGGCGGGGCGGCTGTTGG 0: 2
1: 0
2: 7
3: 44
4: 451
1180032915_1180032934 21 Left 1180032915 21:45224490-45224512 CCTGGGTGGGGCAGCTGTGGGGA 0: 1
1: 0
2: 7
3: 55
4: 513
Right 1180032934 21:45224534-45224556 TGGGCGGGGCGGCTGTTGGGGGG 0: 1
1: 1
2: 7
3: 112
4: 859
1180032915_1180032920 -8 Left 1180032915 21:45224490-45224512 CCTGGGTGGGGCAGCTGTGGGGA 0: 1
1: 0
2: 7
3: 55
4: 513
Right 1180032920 21:45224505-45224527 TGTGGGGAGGAACTGGGTTCGGG 0: 1
1: 0
2: 4
3: 36
4: 345
1180032915_1180032935 27 Left 1180032915 21:45224490-45224512 CCTGGGTGGGGCAGCTGTGGGGA 0: 1
1: 0
2: 7
3: 55
4: 513
Right 1180032935 21:45224540-45224562 GGGCGGCTGTTGGGGGGAACTGG 0: 1
1: 0
2: 2
3: 27
4: 227
1180032915_1180032927 10 Left 1180032915 21:45224490-45224512 CCTGGGTGGGGCAGCTGTGGGGA 0: 1
1: 0
2: 7
3: 55
4: 513
Right 1180032927 21:45224523-45224545 TCGGGGAGCCCTGGGCGGGGCGG 0: 2
1: 2
2: 2
3: 45
4: 439
1180032915_1180032923 2 Left 1180032915 21:45224490-45224512 CCTGGGTGGGGCAGCTGTGGGGA 0: 1
1: 0
2: 7
3: 55
4: 513
Right 1180032923 21:45224515-45224537 AACTGGGTTCGGGGAGCCCTGGG 0: 1
1: 4
2: 2
3: 11
4: 147
1180032915_1180032919 -9 Left 1180032915 21:45224490-45224512 CCTGGGTGGGGCAGCTGTGGGGA 0: 1
1: 0
2: 7
3: 55
4: 513
Right 1180032919 21:45224504-45224526 CTGTGGGGAGGAACTGGGTTCGG 0: 1
1: 0
2: 6
3: 32
4: 357
1180032915_1180032926 7 Left 1180032915 21:45224490-45224512 CCTGGGTGGGGCAGCTGTGGGGA 0: 1
1: 0
2: 7
3: 55
4: 513
Right 1180032926 21:45224520-45224542 GGTTCGGGGAGCCCTGGGCGGGG 0: 1
1: 2
2: 5
3: 25
4: 278
1180032915_1180032930 18 Left 1180032915 21:45224490-45224512 CCTGGGTGGGGCAGCTGTGGGGA 0: 1
1: 0
2: 7
3: 55
4: 513
Right 1180032930 21:45224531-45224553 CCCTGGGCGGGGCGGCTGTTGGG 0: 1
1: 1
2: 2
3: 60
4: 662
1180032915_1180032936 28 Left 1180032915 21:45224490-45224512 CCTGGGTGGGGCAGCTGTGGGGA 0: 1
1: 0
2: 7
3: 55
4: 513
Right 1180032936 21:45224541-45224563 GGCGGCTGTTGGGGGGAACTGGG 0: 1
1: 0
2: 1
3: 12
4: 176
1180032915_1180032933 20 Left 1180032915 21:45224490-45224512 CCTGGGTGGGGCAGCTGTGGGGA 0: 1
1: 0
2: 7
3: 55
4: 513
Right 1180032933 21:45224533-45224555 CTGGGCGGGGCGGCTGTTGGGGG 0: 1
1: 0
2: 3
3: 33
4: 319
1180032915_1180032925 6 Left 1180032915 21:45224490-45224512 CCTGGGTGGGGCAGCTGTGGGGA 0: 1
1: 0
2: 7
3: 55
4: 513
Right 1180032925 21:45224519-45224541 GGGTTCGGGGAGCCCTGGGCGGG 0: 1
1: 4
2: 9
3: 63
4: 472
1180032915_1180032921 -7 Left 1180032915 21:45224490-45224512 CCTGGGTGGGGCAGCTGTGGGGA 0: 1
1: 0
2: 7
3: 55
4: 513
Right 1180032921 21:45224506-45224528 GTGGGGAGGAACTGGGTTCGGGG 0: 1
1: 0
2: 1
3: 20
4: 273
1180032915_1180032932 19 Left 1180032915 21:45224490-45224512 CCTGGGTGGGGCAGCTGTGGGGA 0: 1
1: 0
2: 7
3: 55
4: 513
Right 1180032932 21:45224532-45224554 CCTGGGCGGGGCGGCTGTTGGGG 0: 1
1: 0
2: 1
3: 66
4: 731
1180032915_1180032924 5 Left 1180032915 21:45224490-45224512 CCTGGGTGGGGCAGCTGTGGGGA 0: 1
1: 0
2: 7
3: 55
4: 513
Right 1180032924 21:45224518-45224540 TGGGTTCGGGGAGCCCTGGGCGG 0: 1
1: 3
2: 1
3: 33
4: 347
1180032915_1180032922 1 Left 1180032915 21:45224490-45224512 CCTGGGTGGGGCAGCTGTGGGGA 0: 1
1: 0
2: 7
3: 55
4: 513
Right 1180032922 21:45224514-45224536 GAACTGGGTTCGGGGAGCCCTGG 0: 1
1: 3
2: 1
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180032915 Original CRISPR TCCCCACAGCTGCCCCACCC AGG (reversed) Exonic
900289756 1:1918921-1918943 TCCCCACAGGTGCCCGCCCCAGG - Exonic
900345622 1:2209001-2209023 ACCCAGCAGCTGCTCCACCCTGG + Intronic
900394962 1:2449620-2449642 TGGGCAGAGCTGCCCCACCCAGG - Intronic
900469886 1:2848475-2848497 AACCCAGAGCTGCCCCTCCCAGG - Intergenic
900622393 1:3593424-3593446 TCTCCACCCCCGCCCCACCCAGG + Intronic
900647200 1:3714371-3714393 TCCCCACAGCTGACAAAGCCGGG + Intronic
900997558 1:6130671-6130693 TCCCCGCAGCTTCCCACCCCTGG + Intronic
901204292 1:7485047-7485069 TCCCCAGAGCTGCCCGGACCTGG + Intronic
901320440 1:8336926-8336948 TCCCCTCCCCTGCACCACCCAGG + Intronic
901494662 1:9614107-9614129 GCCCCTCCGCTGTCCCACCCTGG + Exonic
902210600 1:14901790-14901812 CCCCCACAGCTGCCTCTCTCTGG + Intronic
902923810 1:19682813-19682835 TCCCCAGAGGAGCCCCACCAGGG - Exonic
903153888 1:21431069-21431091 CCACCACAGTTGCCCCACCATGG + Intergenic
903876455 1:26477591-26477613 TCCTCACAACTGCCCGACCTCGG - Intergenic
904249089 1:29209891-29209913 TTCCCACAGCTGACCCACATAGG - Intronic
904365889 1:30010667-30010689 TCCCCAAGGTTGCCCCACGCCGG - Intergenic
904490465 1:30855705-30855727 TCCCCACAGGTCCCTCAGCCAGG - Intergenic
904622765 1:31785128-31785150 TCCCCCCACCTTCCCCAGCCTGG - Intergenic
904813994 1:33181822-33181844 TCCCCGCACCGCCCCCACCCCGG - Intronic
904835005 1:33330010-33330032 TCCCCACAGCTTCCCTTCCATGG - Intronic
904869756 1:33609097-33609119 TTAGCACAGCTGCCACACCCAGG - Intronic
905173919 1:36124923-36124945 CCCCCACCGCGTCCCCACCCCGG + Intronic
905486548 1:38301277-38301299 TCCCCTCTGCTGCCCCGGCCAGG + Intergenic
905626525 1:39493195-39493217 GCCCCACAGCTCCCCCACTTCGG - Intronic
906207464 1:43994882-43994904 TCCCCTCGCCTGCCTCACCCTGG - Intronic
906380186 1:45327611-45327633 TCCACGCGGCTGACCCACCCGGG - Exonic
907238718 1:53068940-53068962 TCCCCTCAGCTGCCCTCACCAGG - Intronic
908612822 1:65881358-65881380 ACCCCATGGCTGCCCCAGCCAGG - Intronic
909914037 1:81295491-81295513 ACCCTACACCTGCCCCATCCTGG + Intergenic
910065106 1:83142950-83142972 ACAACACAGCTGCCCCATCCAGG - Intergenic
911617362 1:100029146-100029168 TTCCAACATCTGCCCCTCCCTGG + Intergenic
912681452 1:111731909-111731931 TCCCCACTCCTGCCCCATGCAGG + Intronic
915251196 1:154589915-154589937 TCCCCACAGCTCCCTCTCACTGG - Exonic
915513715 1:156400888-156400910 TCCCCACAGCTTCTCCACAAAGG + Intergenic
917141618 1:171841402-171841424 GCCCCGCGGCTGCCCCGCCCCGG - Intergenic
918075984 1:181171907-181171929 TCCCCACTGCTGCCCTACAAGGG - Intergenic
918812484 1:189139812-189139834 GCCCGGCAGCTGCCCCATCCGGG - Intergenic
919565593 1:199181377-199181399 TCCTCTCAGCTCCCCAACCCTGG - Intergenic
920388758 1:205585943-205585965 TCCCCACACCTGCCCAGCCTGGG + Intronic
921101666 1:211933927-211933949 TACACTCAGCTGCCCGACCCTGG - Intergenic
921174895 1:212585204-212585226 GCCCCAGAGCTGCCACACACAGG - Intronic
922113212 1:222583230-222583252 TCCTCACAGCTGCCGGACACTGG - Intronic
922211438 1:223489764-223489786 ACCCTTCAGATGCCCCACCCTGG - Intergenic
923327344 1:232892451-232892473 TCCCCAAAGATGTCCCATCCTGG + Intergenic
923505444 1:234601407-234601429 TTCCCACCGCCCCCCCACCCCGG + Intergenic
924007747 1:239630894-239630916 TCCCCACTGCTGCCCTCCCCCGG - Intronic
1062917075 10:1248596-1248618 GCACCACAGCCGCCCCATCCTGG - Intronic
1062935216 10:1380432-1380454 TGTCCACAGGTGCCCCACCGTGG + Intronic
1063123764 10:3122982-3123004 TCACCACATCAGCCCCGCCCAGG - Intronic
1063365647 10:5488726-5488748 CCCCCACCGCTGACCCACCAGGG + Intergenic
1064145333 10:12822355-12822377 TCCCCACTGCTGCACAGCCCAGG + Intronic
1064654895 10:17547166-17547188 TCTCCACAGCAGGCCTACCCTGG + Intergenic
1065047474 10:21757305-21757327 TGGCCACAGCTGTCACACCCTGG + Intronic
1065962303 10:30743645-30743667 GTCCCACAGCTGCCCCATTCTGG + Intergenic
1067346283 10:45441260-45441282 GACCCGCAGCTCCCCCACCCAGG - Intronic
1069593573 10:69656386-69656408 TCCCCTCCGCTCCCCTACCCAGG - Intergenic
1069662228 10:70131498-70131520 GCCCCAGAGCTGCCCTCCCCTGG - Intronic
1069686266 10:70321001-70321023 TCCCCAAAGCGGCCCCAACCTGG - Intronic
1070622954 10:78028057-78028079 TCCACACAGCTGCCCAAGCAAGG + Intronic
1070625376 10:78047353-78047375 TCTCCACAGCTGTCCCCCTCTGG - Intronic
1070788338 10:79175229-79175251 TCGGGGCAGCTGCCCCACCCTGG - Intronic
1071300662 10:84253773-84253795 TCCTTCCAGCTGCCCCTCCCTGG + Intronic
1071496301 10:86169798-86169820 TCCCCAAAGATGTCCCATCCTGG + Intronic
1072810230 10:98455852-98455874 TCGGCACAACTGCCCCAGCCTGG - Intergenic
1073110677 10:101061497-101061519 CCCACCCAGCTGCCCCACCAAGG - Intergenic
1073420704 10:103421563-103421585 GCCCCACAGGTGCCCCACCTCGG - Exonic
1073455726 10:103635711-103635733 ACCCCAAAGCTGCCTCACCCTGG + Intronic
1073461282 10:103667309-103667331 TCCCCACGACTCCCCAACCCTGG + Intronic
1074419651 10:113297860-113297882 TCCCCTCCGCTGCCCCAACCAGG + Intergenic
1075709213 10:124521695-124521717 ACCCGCCAGCTGCCCCAGCCTGG - Intronic
1075713687 10:124544032-124544054 TTCCCAGAGCTGCCGCACCCTGG + Intronic
1075790098 10:125077924-125077946 TCCCCCCATCAGCACCACCCAGG - Intronic
1076408539 10:130230175-130230197 TCAGCACAGCCGCCCCACACAGG - Intergenic
1076420921 10:130331066-130331088 TCCCCACCCCTCCCCCACCATGG + Intergenic
1076472004 10:130725431-130725453 ACCGCACAGCAGCCCCTCCCAGG - Intergenic
1076478706 10:130769846-130769868 TCCCCTCAGCAGCCTCACCCTGG - Intergenic
1076495281 10:130893179-130893201 TCCCCAGAGCTTCCACACCATGG + Intergenic
1077141728 11:1027757-1027779 TCCCCACATCTGTGCCGCCCTGG - Exonic
1077205051 11:1337877-1337899 TCACCAGAGCCGCCCCTCCCAGG + Intergenic
1077228681 11:1449234-1449256 TGCCAGCAGCTGCCCCAGCCTGG + Intronic
1077232089 11:1462290-1462312 CCCCCACGGCCGCCGCACCCGGG - Intronic
1077368992 11:2172828-2172850 TCCCAGCCGCTGCCCCACCCAGG + Intergenic
1077464349 11:2726521-2726543 ACCCCACCCCTGCCCCACCATGG + Intronic
1077487376 11:2845297-2845319 TCCCCACAGCTCCCACCCCAAGG - Intronic
1077539384 11:3139429-3139451 TCTCCACCTCTGCCCCAGCCTGG - Intronic
1078276076 11:9848083-9848105 TCCCCACCCCCTCCCCACCCTGG - Intronic
1079377830 11:19909556-19909578 TCCCCACCTCTTCCCCAGCCAGG - Intronic
1080391891 11:31855723-31855745 TCACCACAGGTGCCGCACACTGG - Intronic
1080888893 11:36391354-36391376 TCCTCACAGCTGCCACGCCAGGG - Intronic
1082000469 11:47391268-47391290 TACCCTCACCAGCCCCACCCAGG - Intergenic
1082029463 11:47594129-47594151 TCCCCTCAGCTGCCCTCACCTGG + Exonic
1083151691 11:60795619-60795641 TGCCCACAGCTGTCACAGCCTGG + Exonic
1083186832 11:61022517-61022539 TCACCCCAGCTCTCCCACCCAGG + Intergenic
1083669316 11:64291529-64291551 TCCCCACAGCCGGCCAGCCCCGG - Intronic
1083805831 11:65073425-65073447 CCTCCCCACCTGCCCCACCCTGG - Intronic
1083839729 11:65297384-65297406 TCACTGCAGCTGCCCCTCCCTGG - Exonic
1083904764 11:65662587-65662609 TTCCCTCTGCTCCCCCACCCAGG + Intronic
1084462153 11:69302138-69302160 TCTCCTCAGCAGCCACACCCAGG + Intronic
1084476790 11:69393938-69393960 TCCACAGAGCTTTCCCACCCTGG - Intergenic
1084593914 11:70105966-70105988 TCCTCTCAGCTGCCCCTGCCTGG - Intronic
1084712669 11:70853553-70853575 TCCCAACAGCTCCACCAGCCCGG + Intronic
1085036368 11:73302579-73302601 TCCCCACCCCCACCCCACCCGGG - Intergenic
1085387132 11:76163776-76163798 TCCCCAAACCTACACCACCCAGG - Intergenic
1087155020 11:94893987-94894009 TGCCCACGTGTGCCCCACCCGGG - Intergenic
1088489681 11:110374828-110374850 TCACCACAGCAGCCTCAACCTGG - Intergenic
1088842976 11:113642176-113642198 CCCCCACACCTTCCCCACCCAGG + Intergenic
1089063644 11:115645916-115645938 TCCCCACAGCTGCTACTCCCAGG - Intergenic
1089348743 11:117809238-117809260 TCCCAGGACCTGCCCCACCCTGG - Intronic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1091689803 12:2588247-2588269 TCCCAACCGCTGCCCCTTCCAGG + Intronic
1091727324 12:2855113-2855135 TGCCCACAGATGCCCCCCCACGG - Intronic
1092165755 12:6341445-6341467 CCGCCAAATCTGCCCCACCCTGG + Intronic
1092838186 12:12511875-12511897 ACTACACAGCTGCCCCACCTGGG + Intronic
1094487063 12:30933716-30933738 TCCCCAGAGCAGCCCCTCCTAGG - Intronic
1096105515 12:48995090-48995112 TCCCCACAGTGGCCCTCCCCCGG - Intergenic
1096672315 12:53207290-53207312 ACCCCAAATCTTCCCCACCCTGG - Exonic
1096879739 12:54658050-54658072 TCCCTACAGCAGCTCCAACCCGG - Intergenic
1097233313 12:57524985-57525007 GCCCCACCCCAGCCCCACCCGGG - Exonic
1098443175 12:70539162-70539184 TCCCCACAACAGCCCCACAAGGG + Intronic
1098534665 12:71581237-71581259 TCTCCTCACCTACCCCACCCCGG + Intronic
1098596041 12:72273574-72273596 TGCCCCGCGCTGCCCCACCCCGG + Intronic
1101656304 12:106723522-106723544 GCCCCTCAGCTGTCACACCCAGG - Intronic
1101884397 12:108649135-108649157 TCCCCACATCTGATCCACCCCGG + Intronic
1102199322 12:111046555-111046577 TGGCCAAAGCTGCCCCTCCCAGG + Intronic
1102508831 12:113400750-113400772 TCTCCTCAGAGGCCCCACCCTGG - Intronic
1102644633 12:114396182-114396204 GCCCCGCGGCTGCCCGACCCCGG + Intronic
1103278299 12:119732551-119732573 TCCTCCCAGCTTCCCCACTCAGG - Intronic
1103904805 12:124321740-124321762 TCCCCAAAGAGGGCCCACCCTGG - Intergenic
1103912756 12:124361303-124361325 TCCCCAGAGGTTCCCCACCCTGG - Intronic
1104421080 12:128635959-128635981 TCCCCATAGCTGCCCAATCTCGG + Intronic
1104424372 12:128662947-128662969 TACCCACAGCTGACTGACCCTGG - Intronic
1104653508 12:130556178-130556200 ACTCCACAGCAGGCCCACCCTGG + Intronic
1104767823 12:131341733-131341755 TCCCCTCAGCTGTCCCCTCCAGG - Intergenic
1104789533 12:131473058-131473080 AGCCCACAGCTGCCCTGCCCAGG - Intergenic
1104811897 12:131624349-131624371 TCCCCTCAGCTGTCCCCTCCAGG + Intergenic
1104941571 12:132397792-132397814 TCTACACAGCTGCCCTCCCCGGG + Intergenic
1105060541 12:133146349-133146371 TCCACACAGCTCACCCTCCCTGG + Intronic
1105642841 13:22284220-22284242 TCCCCACCGCTCCCCGGCCCTGG + Intergenic
1106120850 13:26859227-26859249 TCCACACAGCTGCCTTGCCCTGG + Intergenic
1106247769 13:27963506-27963528 TCCCCATAACAGCCCAACCCTGG + Intronic
1106303834 13:28494046-28494068 TCCCGGCAGAGGCCCCACCCGGG + Intronic
1106479260 13:30124380-30124402 TCCCCACTGGGGCACCACCCAGG + Intergenic
1106600852 13:31185460-31185482 TCCACCCAGCTGCCTCCCCCAGG + Intergenic
1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG + Intergenic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1108519477 13:51233545-51233567 TCCCCCTACCCGCCCCACCCCGG - Intronic
1111281036 13:86025328-86025350 TTGCCACAGCCACCCCACCCTGG - Intergenic
1113092592 13:106630860-106630882 TCTCCACAGCTTCCCCAGCGAGG + Intergenic
1113508203 13:110831567-110831589 ACCCCACTGCAGCCCCACACAGG + Intergenic
1113519482 13:110929448-110929470 GCCCCTCAGCTGCCTGACCCTGG + Intergenic
1113614369 13:111670468-111670490 TTCCCACAGCTGCACCGCCCAGG + Intronic
1113619837 13:111755382-111755404 TTCCCACAGCTGCACCGCCCAGG + Intergenic
1113847629 13:113401635-113401657 TCCCCACAGCTCCCCCGACAGGG - Intergenic
1113983009 13:114292042-114292064 ACCCCACAGGAGCCCCACGCTGG + Intronic
1114316629 14:21515629-21515651 TCACCACAACTCCCCCTCCCGGG + Intergenic
1114482362 14:23043854-23043876 TCAGCACAGCTCCCCCTCCCAGG + Exonic
1114660204 14:24338955-24338977 GCCCCAGAGCTGCTCCAGCCAGG - Intronic
1118768455 14:68925787-68925809 TCAACACAGTTGCCCCACCATGG + Intronic
1119703405 14:76769863-76769885 GCCCCAGAGGCGCCCCACCCTGG - Intronic
1119703944 14:76772647-76772669 TCCCCGCAGCTGCCTGAGCCTGG - Intronic
1120496244 14:85240102-85240124 TCCCCACCCCTGCCCAACCATGG + Intergenic
1120826581 14:88961659-88961681 TACCCCCAACTGCCCCAGCCTGG - Intergenic
1120886006 14:89452333-89452355 TTCCCACAGCAGCTCCACTCAGG - Intronic
1122050823 14:99058537-99058559 ACCCCAAAGCTGACACACCCAGG + Intergenic
1122236695 14:100334593-100334615 TCCCCAAAGCAGCCCCACAGTGG - Exonic
1122623375 14:103072051-103072073 CCTCCACACCCGCCCCACCCGGG - Intergenic
1122798174 14:104216731-104216753 TCACAACAGCGGCCCCAGCCGGG + Intergenic
1122799202 14:104221416-104221438 TCCGCACAGGTGCCCTCCCCAGG + Intergenic
1123070883 14:105642037-105642059 TCCCCACAGCTGCCTGCCCTGGG + Intergenic
1123090544 14:105740321-105740343 TCCCCACAGCTGCCCGCCCTGGG + Intergenic
1123096175 14:105768071-105768093 TCCCCACAGCTGCCCGCCCTGGG + Intergenic
1124143924 15:27103391-27103413 TCCCCACAGCAGGTTCACCCAGG + Intronic
1124379229 15:29150634-29150656 TCCACACAGCTGTCACAGCCAGG - Intronic
1124641630 15:31399713-31399735 GCCCCACAGCGACCCCACCCTGG - Intronic
1125510514 15:40290194-40290216 TCCCCACACCTGCCCCCAGCTGG - Intronic
1127051633 15:55089914-55089936 TGCCCACAGCTGCCTGCCCCGGG + Intergenic
1127269197 15:57385729-57385751 TCCCCCCAACCTCCCCACCCGGG + Intronic
1127582720 15:60352322-60352344 TCCACCCAGCCGCCCCAGCCAGG + Intronic
1127931592 15:63600688-63600710 TCCTCACAGGTGCCCCAACCTGG + Intronic
1128310907 15:66631325-66631347 CCTCCACAGGTTCCCCACCCTGG - Intronic
1128640496 15:69332677-69332699 TCCCCACCCCACCCCCACCCCGG + Intronic
1128709054 15:69858327-69858349 TCTCCACAGCTTCCCTAGCCAGG - Intergenic
1129694517 15:77733101-77733123 CCCCCACAGCTCCCCCATCTAGG + Intronic
1129744113 15:78006490-78006512 TCGCCACAGCTGCCCCCTTCAGG - Intronic
1130044933 15:80436132-80436154 CACCTACCGCTGCCCCACCCAGG - Intronic
1130996159 15:88905578-88905600 TGGCCATAGCAGCCCCACCCAGG - Intronic
1131145574 15:90009516-90009538 TGCCCACCCCTGCCCCAACCTGG + Intronic
1131381155 15:91965071-91965093 TCCCCACAGCCCCCTCTCCCTGG - Intronic
1131507602 15:93031182-93031204 TCCCTACAGTTGCCCCTCCCAGG - Intergenic
1131719291 15:95149841-95149863 GCCCTCCAGCTTCCCCACCCTGG + Intergenic
1132481111 16:166512-166534 CCCCCAGAGCCCCCCCACCCCGG - Intronic
1132576302 16:665943-665965 TCCCCAGAGCTGCCTCTGCCTGG + Exonic
1132600392 16:770368-770390 TCCCGCCATCTGCCCCATCCTGG - Intronic
1132701546 16:1224314-1224336 TCCCCACAGCGTCCCCACCGTGG - Intronic
1132719122 16:1307364-1307386 TCCCCACGGCTGCGCCTCCCAGG + Intergenic
1132744763 16:1432036-1432058 GACCCACAGCAGCCCCAGCCCGG + Intergenic
1132855049 16:2041007-2041029 TCCCCTCAGCTGGCCACCCCAGG + Intronic
1133210714 16:4262024-4262046 CCCCCAAAGCTGCCCAACACAGG + Intronic
1133307642 16:4820919-4820941 TTCCCCCACCTGCCCCACCATGG + Intronic
1134227141 16:12399876-12399898 TTCCCACAGCTGCCCTCCGCCGG - Intronic
1135656018 16:24250183-24250205 AACCCACAGCTGCCCCTTCCAGG - Intergenic
1135777714 16:25271552-25271574 TCCCCACTGCTGCCCTCCCTTGG + Intergenic
1135828092 16:25748159-25748181 TCCCCAGAGCTGCTGCATCCTGG + Intronic
1135899659 16:26445214-26445236 TGCCCAGAGCTTCTCCACCCTGG - Intergenic
1136082451 16:27860977-27860999 TCCCCACCAGTGGCCCACCCTGG - Intronic
1136083251 16:27866958-27866980 TCCCCACCAGTGGCCCACCCTGG + Intronic
1137289688 16:47043464-47043486 TCCTAACAGCTGCCCCAGCCTGG - Intergenic
1138263608 16:55643697-55643719 CCCTCACTGCTGCCCCAACCTGG + Intergenic
1139262181 16:65605096-65605118 CCCCAACACCTGCCCCAACCTGG - Intergenic
1139474221 16:67194526-67194548 TCCCCCTACTTGCCCCACCCAGG - Intronic
1139547065 16:67654323-67654345 TCCCCACAGCTGGGCCCCCGAGG + Exonic
1140295120 16:73702305-73702327 TCCCCACACCTGCAGCCCCCAGG - Intergenic
1141524703 16:84604044-84604066 TCCCTCCCGCTGCCCCACCACGG + Intronic
1141620621 16:85235118-85235140 TCCTCACCGCTGCCCCTCCCAGG + Intergenic
1141722837 16:85766337-85766359 TCCCCACACCTGCCTTACCCAGG - Intergenic
1141889386 16:86916562-86916584 GCCCCCCAGCTGACCCACTCAGG + Intergenic
1142220740 16:88853785-88853807 TCCCCAGGGCTGCCCTGCCCTGG - Intronic
1142600324 17:1050675-1050697 CCGCCCCAGCTGCCCCACCCTGG - Intronic
1142664587 17:1455643-1455665 TCCCCGCGGCTGCCCTCCCCAGG + Intronic
1143248446 17:5504726-5504748 TCCCCTCAGCTACCCACCCCAGG + Intronic
1143388099 17:6543873-6543895 TCCTCCCACCTGCCCCAGCCTGG - Intronic
1143462070 17:7110197-7110219 TCCCCACTGCAGCCACACTCAGG + Intronic
1144586180 17:16489285-16489307 TCCTCGCTGCTGCCCCTCCCTGG + Intronic
1144666765 17:17107371-17107393 TCCCCACATCTACCCAAACCTGG - Intronic
1144827801 17:18116160-18116182 TGCCCACCGCTACCCCAACCTGG - Intronic
1145014554 17:19387722-19387744 TCCCCCCACCAGCCCCAGCCAGG - Intergenic
1145017381 17:19408144-19408166 TCCCCACCTCTGCCCCACCATGG + Intergenic
1145237513 17:21219214-21219236 TCCCCACAGCTGTGCCAGCATGG + Intergenic
1145752257 17:27363617-27363639 TCCACACAGCTGCTCTTCCCAGG + Intergenic
1146260590 17:31417643-31417665 TCCCCACCGCAGCCCCACCTAGG - Intronic
1147148311 17:38498708-38498730 TCTGCGCAGCTGCCCCGCCCCGG + Intronic
1147331177 17:39700307-39700329 TCCCCACACCAGACCCACCTTGG - Exonic
1147374348 17:40015188-40015210 TTCCTCCCGCTGCCCCACCCAGG - Intergenic
1147566782 17:41541302-41541324 CCCCCAGAGCTGACCTACCCCGG + Intergenic
1147670844 17:42176009-42176031 TCCCCCCAGCCGACCCACCAGGG + Intronic
1148777974 17:50106125-50106147 TCCCCTCAGCAGCCCGGCCCTGG - Intronic
1149465746 17:56877691-56877713 ACCCCACAGCTGCCCTAGCTGGG + Intergenic
1149467019 17:56888052-56888074 TAGCCACAGCTTCACCACCCAGG + Exonic
1149493267 17:57100145-57100167 TCCTAACAGCTACCCCACCGGGG - Intronic
1149595743 17:57863537-57863559 CCCCTACAGCTGCTTCACCCCGG - Intronic
1149664920 17:58358585-58358607 TCCCCAGAGCTGCACATCCCCGG - Exonic
1149845366 17:60006428-60006450 CCCCCACACCTCCCCCAGCCTGG + Intergenic
1149992856 17:61392433-61392455 TCCCCCCACCCGCCCCACCGTGG - Exonic
1150493087 17:65587718-65587740 TCCCCACCCCCACCCCACCCTGG - Intronic
1151193194 17:72413487-72413509 ACCGCAAAGCAGCCCCACCCAGG - Intergenic
1151320412 17:73349204-73349226 CCCCCACAGCAGGCCCAGCCAGG - Intronic
1151451462 17:74200668-74200690 TCCCTCCAGCAGCCCCACTCTGG - Intergenic
1151813558 17:76459551-76459573 TGTCCAGAGCTGCCCCACCAGGG + Intronic
1151825034 17:76519330-76519352 CTCCCTCAGCTGCCCCTCCCTGG + Intergenic
1152230591 17:79112340-79112362 TCCCGACACCTCCACCACCCAGG - Intronic
1152308475 17:79535098-79535120 ACCCCGCAGCTGCCACAGCCTGG - Intergenic
1152337617 17:79707316-79707338 TCCCCCCAGCTCCTCCTCCCTGG + Intergenic
1152420029 17:80187725-80187747 TCCCCAGGGCTGCCACACCCAGG + Intronic
1152549474 17:81022284-81022306 TCCTCACAGCTTCACCACACTGG - Intergenic
1154089634 18:11344835-11344857 GCCCAGCAGCTGCCCCATCCGGG + Intergenic
1154420591 18:14224174-14224196 TCTGCCCAGCTGCCCCACCTGGG + Intergenic
1156447878 18:37250389-37250411 TCCCCACAGCTGCCCTGCCTAGG + Intronic
1157045737 18:44100057-44100079 CCAGCACAACTGCCCCACCCTGG - Intergenic
1157667376 18:49499201-49499223 TTCCCGCAGCTGCCCCACGTTGG + Intergenic
1157807572 18:50669472-50669494 TCCCCCCAGCAGCCCCAGCGAGG - Intronic
1157812016 18:50704036-50704058 TCCCCACACCTGCCCTTTCCAGG + Intronic
1158503183 18:58022035-58022057 TCCCCATGGCTCCCCGACCCAGG - Intergenic
1159334378 18:67044102-67044124 TCCCAACATCTGCCCAACTCTGG - Intergenic
1159475464 18:68915266-68915288 TCCTCACACCTGCCTCACCTTGG - Intronic
1160027315 18:75229091-75229113 GCCCAACACCTGCCCCGCCCAGG - Intronic
1160681152 19:412176-412198 TCCCTGCCCCTGCCCCACCCAGG - Intergenic
1160703474 19:518643-518665 TCCCCGCAGCATCCCCAGCCCGG - Intronic
1160835997 19:1124687-1124709 ATCCCACTGCGGCCCCACCCTGG + Intronic
1160917945 19:1506701-1506723 TCCCCACTCATCCCCCACCCTGG + Intronic
1161086298 19:2337123-2337145 TCCCCACCGCAGCCCCACCACGG - Intronic
1161338927 19:3730174-3730196 CCCCCACAGCGGCACGACCCAGG - Intronic
1161455259 19:4366716-4366738 TCCCCACAGCTGCCTGCCCACGG + Intronic
1161664382 19:5565948-5565970 TTCCCAGAGCTGCCCCAGGCCGG + Intergenic
1161790203 19:6355545-6355567 GCCCGACAGCCACCCCACCCGGG + Intergenic
1162061031 19:8095463-8095485 TCGGCACACCTGCCCCACCAGGG + Exonic
1163239353 19:16050700-16050722 ACCCCAGAACTGCCCCACTCAGG + Intergenic
1163456198 19:17407077-17407099 TGCCCAGAGGTGCACCACCCTGG - Intronic
1163549169 19:17955848-17955870 TCCACAGAGCTGGCCTACCCTGG - Intronic
1163550183 19:17962180-17962202 GCCCACCAGCGGCCCCACCCTGG - Intronic
1163552769 19:17974571-17974593 TCCCCAGAGCAGGCCCACTCTGG - Intronic
1163712255 19:18853822-18853844 GCCTTACAGCTGCCCCACTCTGG - Intronic
1163730908 19:18948708-18948730 TTCCCACAGCTGCTCCCCCAAGG - Intergenic
1163830946 19:19546941-19546963 AGTCCACAGCAGCCCCACCCTGG + Intergenic
1164648078 19:29873539-29873561 TCCCCCGGGCTGCGCCACCCAGG - Intergenic
1164659302 19:29949146-29949168 GCCCCACAGCCGCCCCATCTGGG - Intronic
1164732866 19:30519292-30519314 TGTCCACACCTGCCCCAGCCAGG - Intronic
1164750345 19:30649097-30649119 GCCCGACAGCTGCCCCAGACAGG + Intronic
1164908557 19:31986946-31986968 TCTCCACAGCTCCCCCAAGCAGG + Intergenic
1165822314 19:38684412-38684434 TTCCCAGTGCTGCCCCACCCTGG + Intronic
1166156962 19:40920988-40921010 TCCCCACTGGTGCTTCACCCTGG + Intergenic
1166156998 19:40921227-40921249 TCCCCACTGGTGCTTCACCCTGG + Intergenic
1166871341 19:45872791-45872813 CCCCCACATCTTCCCCGCCCTGG - Exonic
1167150929 19:47709208-47709230 TCCTCACAGCAGCCCCAGCGTGG + Intergenic
1167423587 19:49417752-49417774 TGCCCACAGCTGCCCTCGCCAGG - Exonic
1167470442 19:49672721-49672743 TCCCCACACCTTCCCCATCTCGG - Intronic
1167506018 19:49871527-49871549 TCCCCACATTTGCCCCTCACCGG + Exonic
1167521839 19:49960014-49960036 ACCCCACAGCTTCCTCTCCCTGG + Intronic
1167523544 19:49970708-49970730 ACCCCACAGCTTCCTCTCCCTGG - Intergenic
1167756521 19:51416543-51416565 ACCCCACAGCTTCCTCTCCCTGG + Intronic
1168018936 19:53594883-53594905 CCAGCACAGCTGACCCACCCTGG - Intergenic
1168069685 19:53942651-53942673 TCCCCAGAGCTCCCCAACCTCGG + Exonic
1168102857 19:54150179-54150201 TCCCTGCAGCTGCCCCAGCAGGG - Intronic
1168145757 19:54419318-54419340 TCCCCACCGCCCACCCACCCTGG - Intronic
1168645990 19:58059595-58059617 GCCCCACCTCTGCCCCACACCGG + Intronic
924962582 2:46914-46936 TCCCCTCTGCTCCCCCTCCCCGG - Intergenic
925105583 2:1287953-1287975 TCGCCCCAGGTGCTCCACCCCGG - Intronic
925306122 2:2849187-2849209 TCCCCAAAGCTGTCCCACCCAGG + Intergenic
925861061 2:8175510-8175532 TCCACACTGCTGCTTCACCCTGG - Intergenic
926142064 2:10373730-10373752 CCCCCACAGCAGCCCAGCCCAGG + Intronic
926973855 2:18493830-18493852 TCACCACATCCGCCCCACCATGG + Intergenic
927515324 2:23668798-23668820 TCCCCACTGCTGCTCCATCAAGG + Intronic
927548430 2:23975711-23975733 TCCCCACAGCTTCCACCTCCTGG + Intronic
927558052 2:24049797-24049819 TCCCTGCTGCTGCCCGACCCCGG - Exonic
928437817 2:31267046-31267068 TCCCCAGTGCTTCCACACCCGGG + Exonic
930152155 2:48069958-48069980 TCCCCTCAGTGGCCACACCCTGG - Intergenic
931433344 2:62227495-62227517 TCCTGACAGCTGACCCACACGGG + Intergenic
932449558 2:71800794-71800816 TCCCCACCCGTGCCCCATCCAGG + Intergenic
932780560 2:74556104-74556126 CTCCCACAGCTGCCCAACCCAGG - Intronic
933902887 2:86861951-86861973 CCCCCCCAGCTCCCCGACCCAGG - Intergenic
934713465 2:96530007-96530029 TCCCCACATCTGGGGCACCCTGG - Intergenic
934845016 2:97656947-97656969 TCCCCACAGCGGCTCCATCCTGG - Exonic
935777658 2:106487319-106487341 CCCCCCCAGCTCCCCGACCCAGG + Intergenic
936066326 2:109335209-109335231 TCCCCACAGCTGCTCCTCTGAGG - Intronic
937044329 2:118843273-118843295 TCCCCACCCCCACCCCACCCCGG - Intronic
937911689 2:127078717-127078739 TCCCCACTGCTGCCCCTCCCTGG + Intronic
938117458 2:128611707-128611729 TCCCCACTCCCACCCCACCCTGG - Intergenic
938231908 2:129668849-129668871 TACACACAGCGTCCCCACCCAGG - Intergenic
940004602 2:148999241-148999263 TCCCCACCCCCACCCCACCCAGG + Intronic
940910300 2:159204387-159204409 TCAGCACAGGTGCCCCACCGAGG - Intronic
942535883 2:176963284-176963306 TGCCCACAACTGCTCCACCTGGG - Intergenic
943692450 2:190881708-190881730 GCCCCACCGCGGCCCCACCAGGG - Intronic
947122944 2:226836176-226836198 TCCGCCCAGCAGCCCCAGCCCGG - Intronic
947476072 2:230448767-230448789 TCCCCAGAGCTACCCTGCCCAGG - Intronic
947816788 2:233042744-233042766 TCCAGCCAGCTGCCCGACCCAGG + Intergenic
948384717 2:237574480-237574502 TGCCCCCAGCTGCCCTTCCCAGG + Exonic
948606785 2:239140970-239140992 CACCCACAGCTCCCCCAACCTGG + Intronic
948699444 2:239750944-239750966 TCCCCCCAGCAGCCTCTCCCAGG - Intergenic
948714503 2:239852018-239852040 TCCCCACCACCCCCCCACCCAGG - Intergenic
948777832 2:240299114-240299136 TCCCCAGAGCTGCCCCGTCCAGG + Intergenic
949060870 2:241956628-241956650 TCTCCACATCTGCCCCTCACAGG - Intergenic
1169343512 20:4813223-4813245 TCCCCGGAGCTGCCCCTGCCTGG + Intronic
1170428270 20:16256822-16256844 TTCCCTCCACTGCCCCACCCAGG - Intergenic
1170880477 20:20292682-20292704 TCACCACAGCCTCCCCACCTGGG + Intronic
1173565773 20:44037395-44037417 TCCTCACAGCTGCCCCATGAGGG + Intronic
1174454823 20:50641680-50641702 TCCCCATCTCTTCCCCACCCAGG + Intronic
1174471976 20:50768048-50768070 TCCCCATCTCTTCCCCACCCAGG - Intergenic
1174518122 20:51108971-51108993 TACCCACAGCTGCTCCTCCTCGG + Intergenic
1175064488 20:56273375-56273397 TACCCTCAGTTGCCCTACCCAGG - Intergenic
1175238155 20:57526789-57526811 TCCCCACCCCTGCCCCGCCTAGG - Intergenic
1175248911 20:57597254-57597276 TGACCCCAGCGGCCCCACCCGGG - Intergenic
1175277564 20:57782635-57782657 TCCCCAAAGCTGCCTTGCCCAGG + Intergenic
1175608555 20:60331314-60331336 TCCCTCCATCTTCCCCACCCTGG + Intergenic
1175953393 20:62595855-62595877 CCTCCACAGCTGCACCTCCCGGG - Intergenic
1176129422 20:63490399-63490421 TGCCGACAGCAGCCTCACCCAGG + Intronic
1176296701 21:5076861-5076883 TGCCCACAGCTGCCCCCTCCAGG - Intergenic
1178894755 21:36549299-36549321 TCCCCACCCCTGCCCCCCTCCGG + Intronic
1179269369 21:39838620-39838642 TCCCAACAACTGCTCCTCCCAGG - Intergenic
1179295729 21:40060566-40060588 CCCCCACCCCTACCCCACCCCGG - Intronic
1179455046 21:41493408-41493430 TCCCCACCTCTCCCCCACTCAGG - Intronic
1179464447 21:41562356-41562378 ACCCCATTGCTGCCCCAACCTGG - Intergenic
1179559166 21:42201936-42201958 TCCCTCCAGGTGCCCCACCCTGG + Intronic
1179598039 21:42456240-42456262 TCCCCACCCCCACCCCACCCTGG - Intergenic
1179860348 21:44185260-44185282 TGCCCACAGCTGCCCCCTCCAGG + Intergenic
1179935720 21:44602383-44602405 GCCCCAAAGCAGCCCCACCCAGG - Intronic
1180032915 21:45224490-45224512 TCCCCACAGCTGCCCCACCCAGG - Exonic
1180032931 21:45224532-45224554 CCCCAACAGCCGCCCCGCCCAGG - Exonic
1180033006 21:45224721-45224743 TCCCCACAGCCGCCCCGCCCAGG - Exonic
1180214280 21:46314780-46314802 CCCCCAGAGCTGCCCCCCACGGG - Exonic
1181111588 22:20605828-20605850 TCCTCACAGCAGACCCCCCCAGG - Intergenic
1181407450 22:22694913-22694935 TCCCCATAGATGACCCACACAGG - Intergenic
1181408471 22:22701774-22701796 TGCCCACTCCTTCCCCACCCTGG + Intergenic
1181527969 22:23500952-23500974 TCCCTACAGCAGCCCCCACCAGG - Intergenic
1181638615 22:24185580-24185602 TCCCCATACCGGCCCCAGCCTGG - Intronic
1181866751 22:25864121-25864143 TTTTCACAGCTGCCTCACCCTGG + Intronic
1181943822 22:26499513-26499535 TCCCAACAGCTGCCACAGTCTGG - Exonic
1182149838 22:28020176-28020198 GCTTCACAGCTGCACCACCCCGG + Intronic
1182265563 22:29112277-29112299 TGGCCACAGCTGCCTCACACTGG - Intronic
1182356412 22:29724145-29724167 TCACGACACCTGCCCCACTCAGG + Intronic
1182490333 22:30667669-30667691 GCCCCTGAGCAGCCCCACCCTGG + Exonic
1183117985 22:35706511-35706533 TCCACAGAGCTGCACCACCTTGG - Intergenic
1183119527 22:35719713-35719735 ACCCCACAGCAGCCCCATCTAGG + Intronic
1183195683 22:36352039-36352061 TGCCCAGAGTTGCCCAACCCAGG + Intronic
1183315930 22:37136772-37136794 TCCGCACACCTCTCCCACCCTGG + Intronic
1183348211 22:37319469-37319491 TCCCCACACCTGCCCTTCGCTGG - Intergenic
1183440149 22:37818363-37818385 TGGCCACAGCTACCCCAGCCAGG - Intergenic
1183474006 22:38026086-38026108 TCCCCTCAGGTGCCCCTGCCTGG + Intronic
1183616629 22:38949931-38949953 TCCCCACTGCTGGCCAGCCCTGG + Intergenic
1183617874 22:38956100-38956122 TCTCCCCAGCTCACCCACCCTGG - Intronic
1183948004 22:41337761-41337783 TCCCCACAGCTGTCCCTCTAGGG - Intronic
1183971662 22:41482085-41482107 TCCCCACAGCAGACCCCCACCGG - Intronic
1184231265 22:43159549-43159571 GGCCCACAGCTTCCCCACCCTGG - Intronic
1184251100 22:43260797-43260819 TCACCCCAGCTGCCCCCGCCAGG - Intronic
1184267497 22:43357005-43357027 TCCCCACAGCTGCGCATGCCGGG + Intergenic
1184642355 22:45879384-45879406 TCCCCACAGCTGACACCCTCCGG + Intergenic
1185092391 22:48783284-48783306 TGTGCACAGCTGTCCCACCCAGG - Intronic
1185163678 22:49244678-49244700 ATCCCAGAGCTGCCACACCCAGG + Intergenic
1185302213 22:50087835-50087857 GCTCCACACCTGCTCCACCCTGG - Intergenic
950093817 3:10316270-10316292 TTTCCCCAGCTGTCCCACCCTGG + Intronic
953769978 3:45772355-45772377 TCCACACTCCTGCCACACCCTGG + Intronic
953828830 3:46277963-46277985 TCCCCACAGTGGCCACCCCCAGG + Intergenic
954222165 3:49161583-49161605 TCTCCACAGGTCCACCACCCAGG + Intergenic
954304429 3:49717926-49717948 TGCCCAGGGCTCCCCCACCCAGG - Exonic
954396675 3:50296807-50296829 TCCCCACAGCCCCCTCTCCCCGG - Exonic
954421263 3:50420270-50420292 TCCTCCCAGCTGCCCCTGCCCGG + Intronic
954567046 3:51607984-51608006 GCCCCGCAGCTGCCCCGCCCGGG - Intronic
954693780 3:52409922-52409944 TCCCCACCGCTGCCCCCACCGGG + Exonic
954798173 3:53172054-53172076 TCCCCATACCTGCTCCTCCCAGG - Intronic
954881285 3:53837610-53837632 TCCCCTCTGCTGCCCCACTGTGG + Intronic
955152909 3:56386435-56386457 TCCCCAAAGCTTCCCAACCTGGG + Intronic
957939885 3:86991104-86991126 TCCCCACGGCTGCCCGACCCGGG - Exonic
959683798 3:109124251-109124273 TCCCGGCAGCTGCCCCGTCCGGG + Intergenic
960658127 3:120028715-120028737 TCCCAACCTCTGCCCCACCATGG - Intronic
960770764 3:121190737-121190759 GCCCGGCAGCTGCCCCATCCGGG - Intronic
961824540 3:129592221-129592243 TCTCCCCAGCTGCCCCAACCAGG + Intronic
962315168 3:134354747-134354769 CTCCCACAGCTGCTCCTCCCTGG - Intergenic
962350234 3:134651030-134651052 TGCGCGCAGCTGCCCCACACGGG + Intronic
962382966 3:134911869-134911891 CCCCCACAGCCATCCCACCCAGG + Intronic
964444436 3:156744007-156744029 TGCCCAGAGCTGCCACACACAGG - Intergenic
965892734 3:173534821-173534843 TCCTCACACCTGCCCAACTCTGG + Intronic
966815219 3:183884849-183884871 TCCCAACCTCTGCCCCACCATGG + Exonic
968550947 4:1223147-1223169 TCCCGACCTCTGCCCCAACCTGG + Intronic
968626204 4:1627769-1627791 TCCCAGCAGCAGCCCCACCTGGG + Intronic
968663871 4:1810316-1810338 TCCCTGAAGCTGCCCCACCAGGG + Intergenic
968705620 4:2076095-2076117 GCCCCTCAGGTGCCCCTCCCAGG + Intronic
968803171 4:2756255-2756277 TCCTCCCAGCCGCCCGACCCCGG + Exonic
968910767 4:3476032-3476054 TGCCCCCACCTGCCCCAGCCTGG + Intronic
969058324 4:4415654-4415676 GCCCTACAGGTGCCCCGCCCAGG - Intronic
969097743 4:4746716-4746738 TCTCCCCAGCTGCCCCAGCAAGG - Intergenic
969130056 4:4984400-4984422 TTCCCCCACCTGCCCCACCTGGG - Intergenic
969179259 4:5424505-5424527 TCCCAACATCTGCCCCAGTCTGG - Intronic
969326745 4:6448608-6448630 CTCCCACTGCTGCCACACCCTGG + Intronic
969339336 4:6530438-6530460 TCCCCAAAGCAGCGCCTCCCGGG - Intronic
969345457 4:6567140-6567162 TCCCCACTTCTGCCCCGGCCGGG + Intergenic
969520894 4:7677292-7677314 TCCCTGCAGCAGCCCCGCCCCGG + Intronic
969617715 4:8263077-8263099 TCCCCACAGCTGCACCTTCCCGG - Intergenic
970594095 4:17584142-17584164 TCCCCACAGCTGCCAACCCTTGG - Intronic
971594766 4:28514794-28514816 TCCGGCCAGCTGCCCCATCCGGG - Intergenic
971792337 4:31185110-31185132 GGGCCACAGCTGCCCCACCATGG - Intergenic
972382130 4:38529136-38529158 ACTCCACAGGTCCCCCACCCAGG + Intergenic
976360082 4:84167635-84167657 TCCCCACAGAAACCCCACACTGG + Intergenic
978389187 4:108206549-108206571 TCCCCACCCCTTCCCCACCAGGG - Intergenic
979703030 4:123689221-123689243 TCCACACAGATTCCCCACCGGGG - Intergenic
981247510 4:142557183-142557205 TCCCATCAGCTGCCCTACCCTGG - Intronic
981528668 4:145732642-145732664 TCCCCCCACCCGCCCCGCCCAGG + Exonic
983628768 4:169828526-169828548 CCCCGCCAGCTGCCCCATCCGGG + Intergenic
984464266 4:180077930-180077952 TCCCCCCAACCCCCCCACCCCGG - Intergenic
985757961 5:1730456-1730478 TCCTGAGAGCTGCCCCTCCCAGG + Intergenic
985801269 5:2006709-2006731 TCCCCACCCCTGCCACACCCTGG + Intergenic
988354134 5:30151245-30151267 TTCCAGCAGCTTCCCCACCCTGG + Intergenic
989506032 5:42228761-42228783 ACAACACAGCTGCCCCACCCCGG - Intergenic
991945181 5:71892730-71892752 TCCCCAGAGCTTCCTCACTCAGG + Intergenic
992782856 5:80143677-80143699 TCCCCTCTGCTGCCCCACCCGGG - Exonic
993634307 5:90325907-90325929 GCAATACAGCTGCCCCACCCTGG - Intergenic
995410903 5:111855991-111856013 TAACCAAAGCTGGCCCACCCAGG - Intronic
997602456 5:135149907-135149929 TCCCCAGAGCTGCCTCAGGCAGG - Intronic
999704286 5:154257338-154257360 TGACCAAAGCTGCCTCACCCTGG + Intronic
1003186426 6:3835368-3835390 TCCCCACTATTGCCCAACCCAGG + Intergenic
1003406911 6:5833629-5833651 TCCCCACAGAGGCCCCTCTCAGG - Intergenic
1004302889 6:14474702-14474724 TCCCCACATCTGCTCCACCCAGG + Intergenic
1004493001 6:16135003-16135025 TCCCTACAGCTGCTCAACACTGG - Intronic
1005334081 6:24775516-24775538 TCCCCACAGCTGGCAAGCCCAGG - Intronic
1005495015 6:26380850-26380872 TCCCAACAGCTGCCCAGTCCTGG + Intergenic
1006034743 6:31202537-31202559 CCCCCACAGCTGCCCAGCCCTGG - Exonic
1006136154 6:31897458-31897480 TCCCCCCACCTCCCACACCCTGG + Intronic
1006515558 6:34543892-34543914 TCCCCAAAGCTGCCCGAGGCTGG + Intronic
1006521503 6:34573710-34573732 TCCCCAAACCTGGCCTACCCGGG - Intergenic
1006798466 6:36745150-36745172 AGCCCACACCTGCCCCACCCAGG - Exonic
1007073067 6:39050189-39050211 TCCTCACAGCGCCCCCAGCCAGG + Intronic
1007816414 6:44528392-44528414 GCCTCACAGTTGCCCCACACCGG - Intergenic
1008554028 6:52657539-52657561 ACTCCAAGGCTGCCCCACCCCGG + Intergenic
1010017046 6:71116966-71116988 CCCCCACACCTCCCCCACTCTGG - Intergenic
1011190132 6:84719620-84719642 TCCCCTCTCCTCCCCCACCCTGG - Intronic
1011474177 6:87735984-87736006 CCCGGCCAGCTGCCCCACCCGGG - Intergenic
1011719531 6:90141178-90141200 TTCCAACTGCTCCCCCACCCAGG + Intronic
1012624639 6:101392023-101392045 CCCCCAACCCTGCCCCACCCAGG + Intergenic
1013302540 6:108818086-108818108 TCCCCAAAGCTGTGCCTCCCAGG + Intergenic
1013367362 6:109446196-109446218 TCCCCGCAGCTGCTCCGCCTTGG - Exonic
1017935293 6:158999889-158999911 TCCGCCCAGCCGCGCCACCCAGG + Exonic
1018096398 6:160390629-160390651 TCCACACAGCTGCATCTCCCTGG - Intronic
1018216088 6:161529308-161529330 TCCCTCCAGCTGCCTCACCTGGG + Intronic
1018478592 6:164167896-164167918 GGCCCACAGCTGCCTCACTCAGG - Intergenic
1019186686 6:170224628-170224650 GCCCCACTGCTGCCGCACACAGG + Intergenic
1019410562 7:904854-904876 AAGCCTCAGCTGCCCCACCCTGG + Intronic
1019513429 7:1429610-1429632 TTCCCAGAGCCCCCCCACCCAGG + Intronic
1019605420 7:1907658-1907680 CCCCCACTCCTGCCACACCCAGG - Intronic
1019705103 7:2493858-2493880 TCCACACAGCCACCCCACGCTGG + Intergenic
1022206715 7:28171555-28171577 TGCCCACAGCTGCACCAGCGGGG - Intronic
1022213688 7:28236944-28236966 TGCCCACAGCTGCCCTGCCTCGG - Intergenic
1023166697 7:37350032-37350054 TCCCCCCACCTGCCCTACACTGG + Intronic
1024664856 7:51536354-51536376 CACCCACAGCTGCCCCTTCCCGG + Intergenic
1025803454 7:64809184-64809206 CCCGGCCAGCTGCCCCACCCGGG - Intronic
1026482551 7:70790798-70790820 TCCCCGCATCAGCCCCACCGCGG + Exonic
1026931785 7:74226921-74226943 TCCCCTCACCTGCTCCTCCCTGG - Intronic
1027279001 7:76591798-76591820 ACAACACAGCTGCCCCACCCAGG + Intergenic
1029578752 7:101420962-101420984 TCCCCACAGCCTGCCCAGCCTGG + Intronic
1030082214 7:105787967-105787989 TCCACGTGGCTGCCCCACCCCGG - Intronic
1031970475 7:128061433-128061455 ACCCCACAGCTTCTCCACACAGG - Intronic
1032079953 7:128853855-128853877 TCCCACCACCCGCCCCACCCAGG - Intronic
1032545386 7:132737617-132737639 TCCCCACAGCTTCCCTGCCCTGG + Intergenic
1034217521 7:149420026-149420048 CCCCCTCTGCTGCCCCACACTGG - Intergenic
1034787197 7:153936355-153936377 TCCCCACCCCAGCCCCATCCTGG - Intronic
1035243957 7:157550470-157550492 GCCCCACAGCGGCTCCACCAGGG + Intronic
1035373200 7:158392120-158392142 TCCCCACGGAAGCCCCAGCCTGG - Intronic
1035597800 8:872865-872887 TCCTGGCACCTGCCCCACCCTGG - Intergenic
1035720255 8:1785972-1785994 TCCCAGGAGCTGCCCCTCCCTGG + Exonic
1036750088 8:11438208-11438230 TCCCCACAGCAGCACCTCACCGG - Exonic
1038692275 8:29774202-29774224 CCCACTCAGCTGCCTCACCCTGG + Intergenic
1039563129 8:38528964-38528986 TCTGCACTGCTTCCCCACCCTGG - Intergenic
1040052800 8:43033043-43033065 CCCCCCCAGCCGCCCCGCCCGGG - Intronic
1040298233 8:46174347-46174369 CCCCCACAGCTGTCCCAGGCAGG + Intergenic
1040975870 8:53194230-53194252 TCACCACAGCTGCACCCCCAGGG - Intergenic
1042166443 8:65950464-65950486 TCCCCGCAGCCGCCACACCCAGG - Intergenic
1042533146 8:69834495-69834517 TCCCCGCCGCTGCCTTACCCAGG + Intronic
1043351318 8:79364084-79364106 TGCCAACAGCAACCCCACCCAGG + Intergenic
1045499225 8:102732193-102732215 TCCCCACAGCTGCGGCATCCAGG + Intergenic
1045969835 8:108067511-108067533 TCCCTACATATGCCTCACCCAGG - Intronic
1046503718 8:115111339-115111361 TCCCCTCATCTGCCCCAGTCTGG + Intergenic
1047202547 8:122779671-122779693 TCCCAACCTCTGCCTCACCCAGG - Intergenic
1048259840 8:132936298-132936320 TCCCAGCAGCTGCTCCTCCCGGG + Intronic
1048271383 8:133030872-133030894 TCCACACTGCTGCCCCACCAGGG - Intronic
1048292561 8:133191860-133191882 TGCCCACATCACCCCCACCCTGG - Intronic
1048366148 8:133740373-133740395 TCCTCACTGCTGCCCAGCCCAGG + Intergenic
1048426393 8:134327936-134327958 TCCCCACAGCTCCGCCATCTTGG + Intergenic
1049177408 8:141202381-141202403 CCCGGCCAGCTGCCCCACCCAGG - Intergenic
1049237666 8:141520214-141520236 GCCCCGGAGCTGTCCCACCCAGG + Intergenic
1049439290 8:142601862-142601884 GCCCCACACCTGTCCCTCCCTGG - Intergenic
1049447331 8:142637322-142637344 TCCCCAAAGGTGCCCAGCCCAGG - Intergenic
1049465606 8:142749990-142750012 TCTCAGCTGCTGCCCCACCCTGG + Intergenic
1049773089 8:144392724-144392746 GCCCCACACCAGCCCCACCACGG - Intronic
1051638428 9:19202587-19202609 GACCCACAGCTGCCTGACCCAGG - Intergenic
1057210189 9:93196950-93196972 TGTCCACAGCTCCCACACCCAGG + Intronic
1057232915 9:93335638-93335660 GCCCCACAGGTGCCCAGCCCAGG - Exonic
1057252597 9:93515983-93516005 GCCCCACAGGTGCCCAGCCCAGG + Exonic
1057473133 9:95375796-95375818 TCCCTACAGCTGACCATCCCAGG - Intergenic
1057565651 9:96164106-96164128 TCCCCACCCCAGCCCCTCCCTGG + Intergenic
1058694393 9:107547233-107547255 TCCCCTCAGCAGTCCCTCCCAGG - Intergenic
1059325862 9:113503689-113503711 TCCCCACCCCTACCCCATCCAGG - Intronic
1059446472 9:114341444-114341466 GCATCTCAGCTGCCCCACCCAGG + Intronic
1059454191 9:114389281-114389303 TCCCAACACTGGCCCCACCCAGG + Intronic
1060191989 9:121599371-121599393 TCCCCACCACCGCCCCGCCCAGG - Intronic
1060557096 9:124513606-124513628 TCCCCATTGCTGCCACCCCCAGG - Intergenic
1060989118 9:127838305-127838327 GCCCCACAGAGTCCCCACCCTGG + Intronic
1061194828 9:129102123-129102145 TCCCCACACCTGCCTCCTCCTGG + Intronic
1061230921 9:129315420-129315442 TCCCCACCCCACCCCCACCCTGG - Intergenic
1061390782 9:130316062-130316084 TCCCCTCTGCTGCACCACCGAGG + Intronic
1061451783 9:130670844-130670866 CCCCCACATCTGCCTCAGCCTGG - Intronic
1062208286 9:135349152-135349174 TCGGCACAGGTGCCCCACCTCGG + Intergenic
1062405760 9:136395530-136395552 CCCCCACAGCTGGGCCTCCCAGG - Intronic
1062449430 9:136609323-136609345 TCCCTGCAGCTGCCCCTCCAGGG + Intergenic
1062454665 9:136629886-136629908 TCACCCCAGCTGCCCAACCGAGG + Intergenic
1062521641 9:136960369-136960391 ACCCCACAGTGTCCCCACCCCGG - Intergenic
1062551207 9:137087371-137087393 CGCCCACGGCTGCCCCAACCAGG - Intronic
1185796813 X:2972527-2972549 TACCCCAAGCTGCCTCACCCTGG + Intergenic
1186483512 X:9914453-9914475 TTCCCACTGCTCCCCTACCCTGG - Intronic
1187713111 X:22073991-22074013 TCCCCACCTCCACCCCACCCAGG - Intronic
1189295548 X:39915120-39915142 TGACCACAGCTGCCTCACTCTGG - Intergenic
1189437728 X:41007740-41007762 TCTCCACTGCTGCCCTGCCCTGG + Intergenic
1190276616 X:48903297-48903319 CCACCACCCCTGCCCCACCCAGG - Intronic
1190597244 X:52062140-52062162 TGCCCCCAGCGCCCCCACCCTGG + Intronic
1190611580 X:52191933-52191955 TGCCCCCAGCGCCCCCACCCTGG - Intronic
1190702710 X:53000183-53000205 GCCCCAGCTCTGCCCCACCCTGG + Intergenic
1192088154 X:68122087-68122109 TCCCCACAGCTACCACAGCTGGG - Intronic
1192223145 X:69211027-69211049 TCCCCCCAGCTGCCACAGGCTGG + Intergenic
1193252556 X:79309112-79309134 TCCCCATAGCTACCACACCTGGG - Intergenic
1193549893 X:82879067-82879089 ACAGCACAGCTGCCCAACCCTGG + Intergenic
1193773958 X:85620566-85620588 GCAATACAGCTGCCCCACCCTGG + Intergenic
1194714613 X:97275341-97275363 CCCGGCCAGCTGCCCCACCCAGG - Intronic
1196106220 X:111898862-111898884 TCCCCACTCCTCCCCCACCAAGG + Intronic
1197754379 X:129983966-129983988 ACCCCAGGGCTCCCCCACCCCGG + Intronic
1198255237 X:134918683-134918705 TCTCCCCAGTTGCCCTACCCAGG + Intergenic
1199005722 X:142693803-142693825 TCACCACAGCTGCCACAGCTAGG - Intergenic
1199191017 X:144970889-144970911 TCCCCACAGCTTCCGCCTCCTGG - Intergenic
1199672030 X:150155554-150155576 TGCCCTCAGAGGCCCCACCCAGG + Intergenic
1199787392 X:151117388-151117410 GCCCCACAGTTGCCCCACTCAGG + Intergenic
1201426519 Y:13857285-13857307 TTCTAAAAGCTGCCCCACCCAGG - Intergenic
1201948278 Y:19535763-19535785 GCCCAGCAGCTGCCCCATCCGGG + Intergenic