ID: 1180037900

View in Genome Browser
Species Human (GRCh38)
Location 21:45259346-45259368
Sequence AAACGGGGCTGGAGTCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180037900_1180037904 -9 Left 1180037900 21:45259346-45259368 CCCTCTGGACTCCAGCCCCGTTT No data
Right 1180037904 21:45259360-45259382 GCCCCGTTTATCTGGAGCAATGG No data
1180037900_1180037911 16 Left 1180037900 21:45259346-45259368 CCCTCTGGACTCCAGCCCCGTTT No data
Right 1180037911 21:45259385-45259407 CTTTTTACATTGGCCAAACTGGG No data
1180037900_1180037910 15 Left 1180037900 21:45259346-45259368 CCCTCTGGACTCCAGCCCCGTTT No data
Right 1180037910 21:45259384-45259406 CCTTTTTACATTGGCCAAACTGG No data
1180037900_1180037908 6 Left 1180037900 21:45259346-45259368 CCCTCTGGACTCCAGCCCCGTTT No data
Right 1180037908 21:45259375-45259397 AGCAATGGACCTTTTTACATTGG No data
1180037900_1180037912 17 Left 1180037900 21:45259346-45259368 CCCTCTGGACTCCAGCCCCGTTT No data
Right 1180037912 21:45259386-45259408 TTTTTACATTGGCCAAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180037900 Original CRISPR AAACGGGGCTGGAGTCCAGA GGG (reversed) Intergenic
No off target data available for this crispr