ID: 1180038434

View in Genome Browser
Species Human (GRCh38)
Location 21:45263294-45263316
Sequence TGCGTAGGAGGGCCGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180038434_1180038439 1 Left 1180038434 21:45263294-45263316 CCCTGCAGCGGCCCTCCTACGCA No data
Right 1180038439 21:45263318-45263340 AGATCCTCCTGATGCATCAGTGG No data
1180038434_1180038442 19 Left 1180038434 21:45263294-45263316 CCCTGCAGCGGCCCTCCTACGCA No data
Right 1180038442 21:45263336-45263358 AGTGGCCCAGCTGCTCCATCTGG No data
1180038434_1180038443 20 Left 1180038434 21:45263294-45263316 CCCTGCAGCGGCCCTCCTACGCA No data
Right 1180038443 21:45263337-45263359 GTGGCCCAGCTGCTCCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180038434 Original CRISPR TGCGTAGGAGGGCCGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr