ID: 1180042579

View in Genome Browser
Species Human (GRCh38)
Location 21:45287824-45287846
Sequence TGCTGCTGGGGGCAGTGTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 405}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180042579_1180042587 11 Left 1180042579 21:45287824-45287846 CCAGGACACTGCCCCCAGCAGCA 0: 1
1: 0
2: 3
3: 43
4: 405
Right 1180042587 21:45287858-45287880 CTGAGTGTCGCCATGGCCCCGGG 0: 1
1: 0
2: 0
3: 19
4: 162
1180042579_1180042588 14 Left 1180042579 21:45287824-45287846 CCAGGACACTGCCCCCAGCAGCA 0: 1
1: 0
2: 3
3: 43
4: 405
Right 1180042588 21:45287861-45287883 AGTGTCGCCATGGCCCCGGGCGG 0: 1
1: 0
2: 1
3: 7
4: 88
1180042579_1180042592 28 Left 1180042579 21:45287824-45287846 CCAGGACACTGCCCCCAGCAGCA 0: 1
1: 0
2: 3
3: 43
4: 405
Right 1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 63
1180042579_1180042586 10 Left 1180042579 21:45287824-45287846 CCAGGACACTGCCCCCAGCAGCA 0: 1
1: 0
2: 3
3: 43
4: 405
Right 1180042586 21:45287857-45287879 GCTGAGTGTCGCCATGGCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 215
1180042579_1180042585 4 Left 1180042579 21:45287824-45287846 CCAGGACACTGCCCCCAGCAGCA 0: 1
1: 0
2: 3
3: 43
4: 405
Right 1180042585 21:45287851-45287873 GACGAAGCTGAGTGTCGCCATGG 0: 1
1: 0
2: 0
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180042579 Original CRISPR TGCTGCTGGGGGCAGTGTCC TGG (reversed) Exonic