ID: 1180042581

View in Genome Browser
Species Human (GRCh38)
Location 21:45287835-45287857
Sequence CTTCGTCTTCCTGCTGCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 393}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180042581_1180042592 17 Left 1180042581 21:45287835-45287857 CCCCCAGCAGCAGGAAGACGAAG 0: 1
1: 0
2: 3
3: 52
4: 393
Right 1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 63
1180042581_1180042594 20 Left 1180042581 21:45287835-45287857 CCCCCAGCAGCAGGAAGACGAAG 0: 1
1: 0
2: 3
3: 52
4: 393
Right 1180042594 21:45287878-45287900 GGGCGGCCACGCACTTCCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 58
1180042581_1180042585 -7 Left 1180042581 21:45287835-45287857 CCCCCAGCAGCAGGAAGACGAAG 0: 1
1: 0
2: 3
3: 52
4: 393
Right 1180042585 21:45287851-45287873 GACGAAGCTGAGTGTCGCCATGG 0: 1
1: 0
2: 0
3: 6
4: 71
1180042581_1180042588 3 Left 1180042581 21:45287835-45287857 CCCCCAGCAGCAGGAAGACGAAG 0: 1
1: 0
2: 3
3: 52
4: 393
Right 1180042588 21:45287861-45287883 AGTGTCGCCATGGCCCCGGGCGG 0: 1
1: 0
2: 1
3: 7
4: 88
1180042581_1180042587 0 Left 1180042581 21:45287835-45287857 CCCCCAGCAGCAGGAAGACGAAG 0: 1
1: 0
2: 3
3: 52
4: 393
Right 1180042587 21:45287858-45287880 CTGAGTGTCGCCATGGCCCCGGG 0: 1
1: 0
2: 0
3: 19
4: 162
1180042581_1180042586 -1 Left 1180042581 21:45287835-45287857 CCCCCAGCAGCAGGAAGACGAAG 0: 1
1: 0
2: 3
3: 52
4: 393
Right 1180042586 21:45287857-45287879 GCTGAGTGTCGCCATGGCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180042581 Original CRISPR CTTCGTCTTCCTGCTGCTGG GGG (reversed) Exonic