ID: 1180042582

View in Genome Browser
Species Human (GRCh38)
Location 21:45287836-45287858
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 230}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180042582_1180042587 -1 Left 1180042582 21:45287836-45287858 CCCCAGCAGCAGGAAGACGAAGC 0: 1
1: 0
2: 0
3: 29
4: 230
Right 1180042587 21:45287858-45287880 CTGAGTGTCGCCATGGCCCCGGG 0: 1
1: 0
2: 0
3: 19
4: 162
1180042582_1180042586 -2 Left 1180042582 21:45287836-45287858 CCCCAGCAGCAGGAAGACGAAGC 0: 1
1: 0
2: 0
3: 29
4: 230
Right 1180042586 21:45287857-45287879 GCTGAGTGTCGCCATGGCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 215
1180042582_1180042585 -8 Left 1180042582 21:45287836-45287858 CCCCAGCAGCAGGAAGACGAAGC 0: 1
1: 0
2: 0
3: 29
4: 230
Right 1180042585 21:45287851-45287873 GACGAAGCTGAGTGTCGCCATGG 0: 1
1: 0
2: 0
3: 6
4: 71
1180042582_1180042588 2 Left 1180042582 21:45287836-45287858 CCCCAGCAGCAGGAAGACGAAGC 0: 1
1: 0
2: 0
3: 29
4: 230
Right 1180042588 21:45287861-45287883 AGTGTCGCCATGGCCCCGGGCGG 0: 1
1: 0
2: 1
3: 7
4: 88
1180042582_1180042594 19 Left 1180042582 21:45287836-45287858 CCCCAGCAGCAGGAAGACGAAGC 0: 1
1: 0
2: 0
3: 29
4: 230
Right 1180042594 21:45287878-45287900 GGGCGGCCACGCACTTCCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 58
1180042582_1180042592 16 Left 1180042582 21:45287836-45287858 CCCCAGCAGCAGGAAGACGAAGC 0: 1
1: 0
2: 0
3: 29
4: 230
Right 1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180042582 Original CRISPR GCTTCGTCTTCCTGCTGCTG GGG (reversed) Exonic