ID: 1180042592

View in Genome Browser
Species Human (GRCh38)
Location 21:45287875-45287897
Sequence CCCGGGCGGCCACGCACTTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180042584_1180042592 14 Left 1180042584 21:45287838-45287860 CCAGCAGCAGGAAGACGAAGCTG 0: 1
1: 0
2: 0
3: 25
4: 229
Right 1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 63
1180042582_1180042592 16 Left 1180042582 21:45287836-45287858 CCCCAGCAGCAGGAAGACGAAGC 0: 1
1: 0
2: 0
3: 29
4: 230
Right 1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 63
1180042581_1180042592 17 Left 1180042581 21:45287835-45287857 CCCCCAGCAGCAGGAAGACGAAG 0: 1
1: 0
2: 3
3: 52
4: 393
Right 1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 63
1180042583_1180042592 15 Left 1180042583 21:45287837-45287859 CCCAGCAGCAGGAAGACGAAGCT 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 63
1180042579_1180042592 28 Left 1180042579 21:45287824-45287846 CCAGGACACTGCCCCCAGCAGCA 0: 1
1: 0
2: 3
3: 43
4: 405
Right 1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180042592 Original CRISPR CCCGGGCGGCCACGCACTTC CGG Exonic
900237398 1:1599317-1599339 GGCGGGCGGCCTCGCGCTTCAGG + Exonic
901012943 1:6211325-6211347 CCCGGTCTGCCATGGACTTCAGG - Intronic
904160429 1:28518632-28518654 CCCGGGCGGCCGCGCGCACCCGG - Intronic
905202318 1:36323185-36323207 CCCGGGCCGCCACGAAGTTAGGG - Intronic
905734355 1:40315633-40315655 CCCGGGGGGCCCCGCTCTCCCGG + Exonic
1063995079 10:11611494-11611516 CCCGGGCGGCCGAGCAGATCCGG + Intronic
1069492027 10:68869108-68869130 CCCAGGCAGCCACAGACTTCCGG + Intronic
1070561695 10:77572505-77572527 CCCAGGCTGCCTCGAACTTCTGG - Intronic
1070582814 10:77735864-77735886 CCCGGGTGGCCCCGCGCTTAAGG - Intergenic
1076648530 10:131971138-131971160 CCCGGGCCGCGCCGCACTCCCGG + Intronic
1076892811 10:133293022-133293044 CCCGGGCGGGCACGCACCGAGGG + Exonic
1084535975 11:69757321-69757343 CCAGGGCGGGCACATACTTCTGG - Intergenic
1087045956 11:93844206-93844228 CCAAGGCTTCCACGCACTTCGGG - Intronic
1092216810 12:6689232-6689254 AGCGCGCGGGCACGCACTTCTGG + Intronic
1107086470 13:36432064-36432086 CCCGGGCGGAGACGCACAGCTGG + Intronic
1113878644 13:113609815-113609837 CCCAGGAGGCCACGCACCTCAGG - Intronic
1114490172 14:23095495-23095517 CCCGGCAGCCCACGCACTTCCGG - Exonic
1124575715 15:30906459-30906481 CCCTGGCTGCCAAGGACTTCAGG - Intronic
1128068002 15:64776009-64776031 CCCGGGCGGCCTCGCGCTTAGGG + Intergenic
1132508573 16:325105-325127 CGCGGGCGGCCCCGCACCCCAGG + Intronic
1132508588 16:325146-325168 CGCGGGCGGCCCCGCACCCCAGG + Intronic
1132900558 16:2251721-2251743 CCCGGGCAGCCGCGCGCTTCCGG + Intronic
1136245497 16:28973721-28973743 CCCTGGCGGACAGGAACTTCAGG - Intergenic
1136705938 16:32188111-32188133 CCCGCGCGGGCACGCCCCTCGGG - Intergenic
1136761974 16:32741294-32741316 CCCGCGCGGGCACGCCCCTCGGG + Intergenic
1136806126 16:33129094-33129116 CCCGCGCGGGCACGCCCCTCGGG - Intergenic
1138100001 16:54244677-54244699 CCCGGGCTGTCACGCTCCTCTGG + Intergenic
1138625776 16:58250167-58250189 TCCGGGCGGCCTCGGACTTGGGG + Intronic
1140407933 16:74723433-74723455 CCTGGGTGGCCACGCCCTACTGG + Intronic
1203064133 16_KI270728v1_random:1001610-1001632 CCCGCGCGGGCACGCCCCTCGGG + Intergenic
1148331555 17:46816945-46816967 CCAGGGCAGCCAGGGACTTCAGG - Intronic
1149626337 17:58083304-58083326 CCCGCCCGGCCCCGCACTGCGGG - Intergenic
1152735261 17:81994125-81994147 CCCGGGCTGCCATGCACATCAGG + Intronic
1153451758 18:5238054-5238076 CCCGCGCCGACACGCACTTCCGG + Intergenic
1161006726 19:1940940-1940962 CCCTCGCGGCCACGCGCTTTCGG + Intergenic
1161323168 19:3650504-3650526 CCCGGGCCTCCACCCACTCCGGG - Intronic
1161356143 19:3820518-3820540 CCCGGGCAGCCATGGCCTTCAGG + Intronic
1161400787 19:4065682-4065704 CCCGGGCGGCCGCGCGGTGCAGG - Intronic
1161438366 19:4277486-4277508 CGGGGGTGGCCATGCACTTCAGG + Intergenic
1161531752 19:4793768-4793790 CCCGGGCCGCAAGGCACTGCAGG - Exonic
1161730638 19:5958663-5958685 CCTGGGCTGCCACCCACTCCGGG - Intronic
1165881897 19:39050172-39050194 CCAGGCCGGCCTCGAACTTCTGG + Intergenic
1168113360 19:54207480-54207502 CCCGGGCGGCCACCCCCGTAGGG - Exonic
927643471 2:24860381-24860403 CCCTGGCGGCCCCGCACCACAGG + Intronic
948886975 2:240889396-240889418 CCCGGCTGGCCACACACTCCAGG + Intronic
1171335424 20:24381188-24381210 CCTGGGGGGCCACTCACGTCAGG + Intergenic
1173165368 20:40683698-40683720 CCAGGGCGGACTCGCACATCAGG - Intergenic
1175264956 20:57696944-57696966 TCCGGGCAGCCATGCTCTTCGGG + Intronic
1175443790 20:59007235-59007257 CCCGGCCGACCCCGCACTTTGGG + Exonic
1175846890 20:62064434-62064456 CCCGTGCGGCCACTCACCTGGGG + Exonic
1179338697 21:40483781-40483803 CCAGGGAGCCCACGCACGTCTGG - Intronic
1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG + Exonic
1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG + Intronic
1183908992 22:41064541-41064563 CCCGGGCGGCCACCCCCATAGGG - Intergenic
1184457983 22:44622153-44622175 CCCACTCGGCCACCCACTTCTGG - Intergenic
953561350 3:43995747-43995769 CCCGGGCTTCCACCCGCTTCTGG + Intergenic
953705441 3:45226516-45226538 CCCGGGCGCCCCCGCGCTCCGGG + Intergenic
954107536 3:48417505-48417527 CCTGGGCTGCCAGGCTCTTCAGG - Intronic
954720162 3:52554738-52554760 CCCGGGAGGCCAGGCACACCTGG + Exonic
984973296 4:185209537-185209559 CCCCGCCCGACACGCACTTCAGG + Intronic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
998353199 5:141514254-141514276 CCCCGGAGGCCACGCCTTTCTGG - Intergenic
1004705771 6:18122432-18122454 CCAGGGCGGCCACGCAGGCCAGG + Exonic
1009934396 6:70216985-70217007 CCCGGGGGTCCAGGCACTCCAGG + Exonic
1024991999 7:55242122-55242144 CCCTGGCGGCCATGCCCATCAGG - Intronic
1031483844 7:122306216-122306238 TGCGGTCGGCCACTCACTTCAGG - Intronic
1043542360 8:81279035-81279057 CCCTGGCTACCAGGCACTTCAGG - Intergenic
1053323441 9:37120500-37120522 CCCGGGAGGGAAGGCACTTCCGG - Intergenic
1056969091 9:91187702-91187724 CCCTGAAGGCCACGCACCTCAGG + Intergenic
1190279315 X:48918877-48918899 CCCGGGCGTCCACGCCCTGCGGG - Exonic
1200147696 X:153935059-153935081 GCCCGGCGGCCGTGCACTTCCGG - Exonic