ID: 1180042592

View in Genome Browser
Species Human (GRCh38)
Location 21:45287875-45287897
Sequence CCCGGGCGGCCACGCACTTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180042581_1180042592 17 Left 1180042581 21:45287835-45287857 CCCCCAGCAGCAGGAAGACGAAG 0: 1
1: 0
2: 3
3: 52
4: 393
Right 1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 63
1180042582_1180042592 16 Left 1180042582 21:45287836-45287858 CCCCAGCAGCAGGAAGACGAAGC 0: 1
1: 0
2: 0
3: 29
4: 230
Right 1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 63
1180042584_1180042592 14 Left 1180042584 21:45287838-45287860 CCAGCAGCAGGAAGACGAAGCTG 0: 1
1: 0
2: 0
3: 25
4: 229
Right 1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 63
1180042583_1180042592 15 Left 1180042583 21:45287837-45287859 CCCAGCAGCAGGAAGACGAAGCT 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 63
1180042579_1180042592 28 Left 1180042579 21:45287824-45287846 CCAGGACACTGCCCCCAGCAGCA 0: 1
1: 0
2: 3
3: 43
4: 405
Right 1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180042592 Original CRISPR CCCGGGCGGCCACGCACTTC CGG Exonic