ID: 1180042667 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:45288157-45288179 |
Sequence | CTCCTGAGGGTCCGCGAGGC CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1180042661_1180042667 | -1 | Left | 1180042661 | 21:45288135-45288157 | CCTGGCGCAGCCCACGCAGGGGC | No data | ||
Right | 1180042667 | 21:45288157-45288179 | CTCCTGAGGGTCCGCGAGGCCGG | No data | ||||
1180042659_1180042667 | 0 | Left | 1180042659 | 21:45288134-45288156 | CCCTGGCGCAGCCCACGCAGGGG | No data | ||
Right | 1180042667 | 21:45288157-45288179 | CTCCTGAGGGTCCGCGAGGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1180042667 | Original CRISPR | CTCCTGAGGGTCCGCGAGGC CGG | Intergenic | ||