ID: 1180042667

View in Genome Browser
Species Human (GRCh38)
Location 21:45288157-45288179
Sequence CTCCTGAGGGTCCGCGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180042661_1180042667 -1 Left 1180042661 21:45288135-45288157 CCTGGCGCAGCCCACGCAGGGGC No data
Right 1180042667 21:45288157-45288179 CTCCTGAGGGTCCGCGAGGCCGG No data
1180042659_1180042667 0 Left 1180042659 21:45288134-45288156 CCCTGGCGCAGCCCACGCAGGGG No data
Right 1180042667 21:45288157-45288179 CTCCTGAGGGTCCGCGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180042667 Original CRISPR CTCCTGAGGGTCCGCGAGGC CGG Intergenic