ID: 1180043838

View in Genome Browser
Species Human (GRCh38)
Location 21:45293836-45293858
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180043838_1180043845 10 Left 1180043838 21:45293836-45293858 CCAGGGTTTCCTGGGGGTGCGCT No data
Right 1180043845 21:45293869-45293891 AAGCCACGTGTGGTCAGCATGGG 0: 1
1: 0
2: 2
3: 8
4: 88
1180043838_1180043852 30 Left 1180043838 21:45293836-45293858 CCAGGGTTTCCTGGGGGTGCGCT No data
Right 1180043852 21:45293889-45293911 GGGGGAGGGGACCAGCGCCCCGG No data
1180043838_1180043851 17 Left 1180043838 21:45293836-45293858 CCAGGGTTTCCTGGGGGTGCGCT No data
Right 1180043851 21:45293876-45293898 GTGTGGTCAGCATGGGGGAGGGG No data
1180043838_1180043841 0 Left 1180043838 21:45293836-45293858 CCAGGGTTTCCTGGGGGTGCGCT No data
Right 1180043841 21:45293859-45293881 GATCCCAAGGAAGCCACGTGTGG No data
1180043838_1180043847 12 Left 1180043838 21:45293836-45293858 CCAGGGTTTCCTGGGGGTGCGCT No data
Right 1180043847 21:45293871-45293893 GCCACGTGTGGTCAGCATGGGGG No data
1180043838_1180043850 16 Left 1180043838 21:45293836-45293858 CCAGGGTTTCCTGGGGGTGCGCT No data
Right 1180043850 21:45293875-45293897 CGTGTGGTCAGCATGGGGGAGGG No data
1180043838_1180043844 9 Left 1180043838 21:45293836-45293858 CCAGGGTTTCCTGGGGGTGCGCT No data
Right 1180043844 21:45293868-45293890 GAAGCCACGTGTGGTCAGCATGG No data
1180043838_1180043846 11 Left 1180043838 21:45293836-45293858 CCAGGGTTTCCTGGGGGTGCGCT No data
Right 1180043846 21:45293870-45293892 AGCCACGTGTGGTCAGCATGGGG No data
1180043838_1180043849 15 Left 1180043838 21:45293836-45293858 CCAGGGTTTCCTGGGGGTGCGCT No data
Right 1180043849 21:45293874-45293896 ACGTGTGGTCAGCATGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180043838 Original CRISPR AGCGCACCCCCAGGAAACCC TGG (reversed) Intergenic